ID: 940801519

View in Genome Browser
Species Human (GRCh38)
Location 2:158137868-158137890
Sequence ATCTAGTTCTAAAGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940801519_940801525 -5 Left 940801519 2:158137868-158137890 CCCTCCTTCCTTTAGAACTAGAT 0: 1
1: 0
2: 0
3: 23
4: 250
Right 940801525 2:158137886-158137908 TAGATTTGCACTGGGAAGACAGG 0: 1
1: 0
2: 0
3: 12
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940801519 Original CRISPR ATCTAGTTCTAAAGGAAGGA GGG (reversed) Intergenic
905057997 1:35115367-35115389 AATGAGTTCTAAAGGAGGGAAGG - Exonic
907194581 1:52676232-52676254 ATCAGCTTCTAAAGGAATGAAGG - Intergenic
909367111 1:74838719-74838741 ATCTATTCCTAAAGCAAAGAAGG - Intergenic
910604547 1:89068583-89068605 GTCTAGTTCTCAGGGAAGAAGGG + Intergenic
911263367 1:95713830-95713852 ATCTCTTTAAAAAGGAAGGAAGG - Intergenic
913183635 1:116346286-116346308 ATCTAATGCTGCAGGAAGGAGGG + Intergenic
914978406 1:152389153-152389175 ATATAGTACCAAAGGAAGGCTGG + Intergenic
915281200 1:154823226-154823248 TCCTAGTTCCAAAGGAAGGCGGG + Intronic
916146592 1:161745583-161745605 ATCCAATCCTAATGGAAGGAGGG - Intergenic
921570509 1:216772732-216772754 ATCTAGTTCCAAAGCCAGAATGG - Intronic
922149698 1:222988631-222988653 ATAAAGCTATAAAGGAAGGAAGG - Intronic
923441646 1:234026518-234026540 ATTTAGTTCTGAAGGTAGGTTGG + Intronic
924017750 1:239745650-239745672 ATCTACTTCTAAAGGGTGGTGGG - Intronic
1064385536 10:14887882-14887904 ACTTAGTACTAAAGGAAGAAAGG + Intronic
1064958124 10:20933840-20933862 TTCTAGTTCTCAAGTGAGGACGG + Intronic
1065593766 10:27292714-27292736 CCCTAATTCTAAAGGAAGCAAGG + Intergenic
1065938855 10:30545846-30545868 ATCTTGTCCTAAATGAAGGAAGG + Intergenic
1065959104 10:30719747-30719769 ATCTGGTTCTATAAGCAGGAAGG - Intergenic
1067024194 10:42829423-42829445 TTCTATTTCTGATGGAAGGATGG - Intronic
1068286587 10:54945193-54945215 AACTATTTCAAAAGGAAGAAAGG + Intronic
1069560268 10:69424277-69424299 TTCTGTTTCTAAAGGAAAGAAGG - Intergenic
1070404188 10:76080066-76080088 ATCTATTTCGAAGGGAAGGGAGG - Intronic
1073727191 10:106247130-106247152 ATTTAATTCTAAAGAAAGGAAGG + Intergenic
1074094677 10:110300765-110300787 AGCTGGTTCTAAAGGAGGCAGGG - Intronic
1076076004 10:127534388-127534410 TTCCAGTTCCGAAGGAAGGAAGG + Intergenic
1076600177 10:131652294-131652316 AATTAGCTCTAAAGGAAGGATGG - Intergenic
1078427818 11:11265763-11265785 CTCTAGCTCTAAGGGTAGGAAGG + Intergenic
1081820243 11:45986646-45986668 ATATTTTTCTGAAGGAAGGAGGG - Intronic
1082216990 11:49583401-49583423 AAGAAGTTATAAAGGAAGGAAGG - Intergenic
1084894407 11:72254957-72254979 ACCTAGTTCTAGAGGCAGCAGGG + Intergenic
1084913057 11:72406861-72406883 ATGTATTTATAAAAGAAGGAAGG - Intronic
1085177612 11:74504574-74504596 TTCTACTTATAAAGGAAGAAGGG + Intronic
1087210626 11:95443272-95443294 ATCTAGCTCTAACGGAACCATGG + Intergenic
1087242828 11:95799249-95799271 ATCAAGGTCTAATGGAAGCATGG + Exonic
1087676583 11:101169471-101169493 ATCTACTCCTGAAGAAAGGAAGG + Intergenic
1088545372 11:110953592-110953614 ATCCACTTCTTATGGAAGGAAGG + Intergenic
1091131786 11:133152729-133152751 ATATATTTATAAAGGAATGAAGG - Intronic
1093269829 12:17046574-17046596 ATCTAGTTCTACAGGCAGACAGG - Intergenic
1093534412 12:20206203-20206225 ATTTAGTTTTAAAGGAATCATGG - Intergenic
1094164898 12:27433761-27433783 ATCTAGAGTTAAAGGAAGAACGG - Intergenic
1097804599 12:63951458-63951480 AAATAGTTCTAAATGAAGGCCGG - Intronic
1097812048 12:64029558-64029580 ATTTAGTGATAAAGGATGGATGG + Intronic
1099925037 12:89006931-89006953 AACTATTTCTAAAGGTAGGGAGG + Intergenic
1100675574 12:96863221-96863243 ATGGAGTTCTAAAAAAAGGAGGG + Intronic
1100852246 12:98725172-98725194 GTCTAGGTCTAAATTAAGGAAGG + Intronic
1101570151 12:105946362-105946384 ATCTGGTTGTAAAGACAGGATGG - Intergenic
1102405611 12:112671590-112671612 ATTTATTACTAAAGGAAGAAGGG + Intronic
1103250353 12:119494620-119494642 GTGTATTTCTAAAGGAAGGGTGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104054337 12:125217752-125217774 ATTTAGAATTAAAGGAAGGAAGG - Intronic
1104523736 12:129499023-129499045 ATATATTTCTGAAGGAATGAAGG - Intronic
1108140411 13:47415445-47415467 AGGTAGCTCTAAATGAAGGAAGG - Intergenic
1109168089 13:59060532-59060554 ATCAAGTTCAGAAGGAAGCAGGG + Intergenic
1109213435 13:59561930-59561952 ATCTAGGTCTATAGCAAGGCTGG + Intergenic
1109241663 13:59897441-59897463 ATATAGTTCTTAAGGAAAGTGGG + Intronic
1109483444 13:62986986-62987008 ATATAGAACAAAAGGAAGGAAGG - Intergenic
1111153606 13:84292892-84292914 ATCTCTTTCTAAAAGAAAGATGG + Intergenic
1115251409 14:31352446-31352468 ATCTAGTTTTAAAGGACTTAGGG - Intronic
1115688511 14:35821329-35821351 TTCTTGTTCTAAAGGAAATATGG - Intergenic
1115783315 14:36795535-36795557 GTTTAGTTTTAAAGGAAGGATGG + Intronic
1119755741 14:77118016-77118038 TTCCACTTCTTAAGGAAGGATGG - Intronic
1119860480 14:77932416-77932438 AGCTAGTTCCAGAGGAAAGAGGG + Intronic
1119906811 14:78312525-78312547 AACTAATTTTAAAGGAAGAAAGG - Intronic
1120082489 14:80231328-80231350 ATCTACTTCTGAAGGAGGCAGGG - Intronic
1120433939 14:84456033-84456055 ATCAATTTTAAAAGGAAGGACGG + Intergenic
1121437675 14:93929737-93929759 ATCTTGGTTCAAAGGAAGGAGGG + Intergenic
1121661825 14:95640774-95640796 ATCTAATTCTGCAGGGAGGAGGG - Intergenic
1122012665 14:98764519-98764541 AACTAGTAGTACAGGAAGGAAGG + Intergenic
1123425348 15:20166463-20166485 TTCTATTTCTGATGGAAGGATGG - Intergenic
1123534571 15:21172995-21173017 TTCTATTTCTGATGGAAGGATGG - Intergenic
1124350636 15:28953249-28953271 ATCTGGTGCTAAAATAAGGAGGG - Intronic
1124798238 15:32803722-32803744 ATCTAGTTGTAATGCCAGGAAGG + Intronic
1124813623 15:32966461-32966483 TTCTAGCTCAAAAGGAAGGCAGG + Intronic
1125257764 15:37785671-37785693 ATCTATTTATAAAAGAGGGATGG - Intergenic
1125616746 15:41021048-41021070 GGCGAGTTCTGAAGGAAGGAGGG - Exonic
1125701906 15:41694044-41694066 TTCTAGTTCTAAGTGGAGGAGGG + Intronic
1126080936 15:44960911-44960933 ATATAGATATAAATGAAGGATGG - Intronic
1128616203 15:69111980-69112002 CTCTGGTTCTTAAGAAAGGATGG - Intergenic
1128963102 15:72029206-72029228 GTAAAGTTATAAAGGAAGGAGGG + Intronic
1132471667 16:107333-107355 TTATATTTCTAAAGGAAGAATGG - Intronic
1136859518 16:33689264-33689286 TTCTATTTCTGATGGAAGGATGG + Intergenic
1141237633 16:82233500-82233522 ACCTAGTTCTGAAGAAAGGGAGG + Intergenic
1143392508 17:6568172-6568194 ATCAGTTTCTAAAGGCAGGAAGG + Intergenic
1144552298 17:16251588-16251610 ATCTAGTTCTCAAGAAAAGAAGG + Intronic
1144608906 17:16691042-16691064 ATGAAGTTCTTAAGGATGGAAGG - Intronic
1145128721 17:20322258-20322280 ATGAAGTTCTTAAGGATGGAAGG - Intergenic
1145195955 17:20895351-20895373 ATGAAGTTCTTAAGGATGGAAGG + Intronic
1147390424 17:40106005-40106027 ATCTGGTTCTAAAAGTAGAAGGG + Intergenic
1148102040 17:45098168-45098190 ATCTATTTCCAAAGGAAGGTGGG - Intronic
1148696459 17:49562741-49562763 AGCAAGCTCGAAAGGAAGGAAGG + Intergenic
1149705107 17:58687816-58687838 ATGTAATTCTAAGGGTAGGAAGG - Intronic
1151019792 17:70601819-70601841 TTCTAGTTCTTAAGGATGTAAGG - Intergenic
1152472747 17:80499429-80499451 AGCCATTTTTAAAGGAAGGAAGG - Intergenic
1156052734 18:32956950-32956972 AAATATTTCTAAAGGAAGGAAGG + Intronic
1156343233 18:36231689-36231711 GTCTATTTCTAAAGGATTGAAGG + Intronic
1156584460 18:38416304-38416326 AACTAGTTCAAAAAGAAAGAAGG + Intergenic
1156625530 18:38903078-38903100 ATCTAGTTCACAACGAAGGGAGG - Intergenic
1159957796 18:74532147-74532169 ATATAGTTTGGAAGGAAGGAAGG - Intergenic
1161665677 19:5574799-5574821 AACTCCATCTAAAGGAAGGAAGG + Intergenic
1165385343 19:35507252-35507274 ATCCAAATCAAAAGGAAGGAAGG + Intronic
1166322736 19:42028686-42028708 CCCTAGTTCTGAAGGAAGAAAGG - Intronic
1167363242 19:49041398-49041420 TTAGAGTTCTACAGGAAGGATGG + Intergenic
925510881 2:4623633-4623655 TTAAAGTCCTAAAGGAAGGATGG + Intergenic
926454782 2:13053422-13053444 ATCTACTTTTAAATGAAGGACGG - Intergenic
928270136 2:29848388-29848410 AGCTAGACTTAAAGGAAGGAAGG + Intronic
929191970 2:39148426-39148448 ATCTATTTGGAAGGGAAGGAAGG + Intergenic
929472400 2:42208283-42208305 ATCTGGTTCTAAATGATGTAAGG - Intronic
930223879 2:48772353-48772375 AGCTAGTTCAAAAAGCAGGAGGG + Intronic
930354675 2:50302807-50302829 ATTGAATTTTAAAGGAAGGATGG + Intronic
931067718 2:58605341-58605363 TTTTAGTTGTAAAGCAAGGAGGG - Intergenic
931683319 2:64770694-64770716 ATCAAGTTCCAAAGGAACAAAGG - Intergenic
931793672 2:65689292-65689314 GTCTATATCTAAAGTAAGGAGGG + Intergenic
933119278 2:78516029-78516051 TTCTAGTTCTGAAGGGATGATGG + Intergenic
933261382 2:80135354-80135376 ATCTAGAGACAAAGGAAGGAGGG + Intronic
933605231 2:84375630-84375652 AGCTAGGTCTAAAGACAGGAAGG - Intergenic
933880356 2:86663658-86663680 ATATAGTTCTAAAAGAACAAAGG + Intronic
933950176 2:87322555-87322577 CTCTAGTTCTACAGGAAGTGCGG + Intergenic
934457876 2:94190384-94190406 TTCTATTTCTGATGGAAGGATGG + Intergenic
935408859 2:102737806-102737828 AACAAGTTCTAAAGAAAAGAGGG - Intronic
935442286 2:103114263-103114285 GTCTACTTCCAAAGGAAGAAAGG + Intergenic
936103944 2:109608434-109608456 ATCTGATTCTTAAGGGAGGAAGG + Intronic
936330012 2:111539042-111539064 CTCTAGTTCTACAGGAAGTGCGG - Intergenic
937213427 2:120293610-120293632 CTGTAGTTCAAAACGAAGGATGG - Exonic
940193187 2:151064256-151064278 GTCTAGTTCTGAAAGAAGAAAGG + Intergenic
940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG + Intronic
940801519 2:158137868-158137890 ATCTAGTTCTAAAGGAAGGAGGG - Intergenic
941498145 2:166233339-166233361 ATCTAGATTTGAAGGAATGAGGG - Exonic
944309589 2:198218541-198218563 CTCTAGGGCTAAAGGGAGGAGGG + Intronic
944932314 2:204532305-204532327 ATCTGGTTCAAAAGTAATGAAGG + Intergenic
946260381 2:218485301-218485323 ATATATATTTAAAGGAAGGAAGG - Intronic
948953611 2:241271360-241271382 AACTAGAACTAAAGGAAGGAGGG + Intronic
1168849735 20:968271-968293 ATCTAGTTGTAAGGGAAGGTGGG - Intronic
1169096483 20:2903772-2903794 AAATATTTTTAAAGGAAGGAAGG + Intronic
1170392745 20:15893022-15893044 ATAATTTTCTAAAGGAAGGAGGG - Intronic
1170605295 20:17871013-17871035 ATTTAGTTGTCAAGGAAAGATGG + Intergenic
1170787513 20:19480417-19480439 ATATAGTCCCAAAGGCAGGATGG - Intronic
1170905208 20:20509105-20509127 ATTTAATACTGAAGGAAGGAGGG + Intronic
1172565755 20:35929058-35929080 GTCTAGCTCTAAAGGAATCAGGG - Intronic
1173724242 20:45286262-45286284 AGCTAGCTCTGAGGGAAGGAGGG + Intergenic
1174872577 20:54196814-54196836 AGTTAGTTCTAAAGGAAGTGAGG + Intergenic
1178037805 21:28604176-28604198 ATCCAGTTCTATATGAAGCAGGG - Intergenic
1178533200 21:33392311-33392333 AGTTAGTTCTACAGGAGGGAGGG - Intergenic
1178684186 21:34698346-34698368 ATTGGGTGCTAAAGGAAGGAAGG + Intronic
1179286537 21:39982633-39982655 GTCTAGTTCTCAAGGAGGGAAGG + Intergenic
1182225112 22:28791746-28791768 ATCTAGTAGAAAAGCAAGGAGGG + Intergenic
1183252471 22:36739821-36739843 ATCAAGTCCTGAAGGAAGGATGG - Intergenic
1183252577 22:36740743-36740765 ATCAAGTCCTGAAGGAAGGATGG + Intergenic
949869466 3:8575546-8575568 CTCTTGTTCTAAAGGAGTGACGG + Intergenic
951829364 3:26907294-26907316 ATCTATCTCGGAAGGAAGGAAGG + Intergenic
952692457 3:36225951-36225973 ATGAATTTATAAAGGAAGGAAGG - Intergenic
953922615 3:46963104-46963126 ATAAGGTTCAAAAGGAAGGAAGG + Intronic
955076963 3:55622988-55623010 ATCCACTTCTAGAGGAAGGCTGG + Intronic
955570546 3:60300428-60300450 CTCAAGTTCTAATGGAAAGATGG + Intronic
956565202 3:70629036-70629058 ACCTAGATCTAAAGGAAGTAGGG + Intergenic
956577605 3:70770959-70770981 ATTTAGTTAGAAAGGAGGGAAGG + Intergenic
957232332 3:77536328-77536350 ATTAAGTTGGAAAGGAAGGAAGG - Intronic
958904949 3:99931591-99931613 GTCTAGTATTAAAGGAATGAAGG + Intronic
959209252 3:103355824-103355846 ACATAATTTTAAAGGAAGGATGG - Intergenic
959926398 3:111926304-111926326 CTCTGGCTCCAAAGGAAGGATGG - Intronic
962881720 3:139584198-139584220 AACAAGTTCTCAAGGAAAGAAGG - Intronic
963008235 3:140746364-140746386 ATTTATTTTTAAATGAAGGAAGG + Intergenic
963031339 3:140981093-140981115 ACTTCGTTCTAAAGGAAAGATGG + Intergenic
964219548 3:154327660-154327682 ACCTGATTCCAAAGGAAGGAAGG - Intergenic
964735997 3:159917802-159917824 ATCAAGTTCTTAAGAAATGATGG - Intergenic
965605136 3:170491014-170491036 GTCAAGTTCTAAAAGGAGGAAGG - Intronic
965684277 3:171285013-171285035 ACTTAGTTCTCAAGGAAAGAAGG - Intronic
966167413 3:177036050-177036072 AACTAGTAATAAAGGAAGGCAGG - Intronic
967588659 3:191246122-191246144 ATCTATTTCTAAAGGGAGTTTGG + Intronic
967617514 3:191589674-191589696 ATCTATTTCTAGAGAAATGAGGG - Intergenic
969896557 4:10310579-10310601 ATGGAGATCTAAAGAAAGGAAGG - Intergenic
972093401 4:35317437-35317459 TTTTAGTTCCAAAGGAAGGAAGG + Intergenic
972831507 4:42819417-42819439 ATCTGGTCCTAGAGGAAGGCAGG + Intergenic
973855579 4:55007301-55007323 ATACAGCTCTAGAGGAAGGAAGG - Intergenic
974392518 4:61290637-61290659 ATCTCAATATAAAGGAAGGAAGG + Intronic
975473923 4:74800235-74800257 ATCAAGGTCTAAAGGCAGTAAGG + Intergenic
975788438 4:77920694-77920716 TTCTTCTTCTAAAGGAAGAAGGG + Intronic
975937419 4:79598912-79598934 GTCTCCTTCTAAAGGAAGGTGGG + Intergenic
975985170 4:80196337-80196359 CTCTACTCCTAAAGGAAGAAAGG - Exonic
976205899 4:82622949-82622971 ATTTTGTTCAACAGGAAGGAAGG - Intergenic
978064656 4:104381700-104381722 ATATAGCTCTAAAGCAGGGATGG - Intergenic
978794597 4:112696635-112696657 ATAAAGTTGGAAAGGAAGGATGG + Intergenic
978845086 4:113263829-113263851 ATATAGTTCTAAAGAAGGCAGGG - Intronic
979567760 4:122175455-122175477 ACCTAGTTCTACAGGAGAGAGGG - Intronic
979910043 4:126353187-126353209 TTCCAGTTCTAAAAGAAAGACGG - Intergenic
982062605 4:151619944-151619966 ATCTAGATGCAAAGGAAGCAGGG + Intronic
982529195 4:156517513-156517535 ATTCATTTCTAAAGAAAGGATGG - Intergenic
982956489 4:161774511-161774533 ATCTAAATCCAAAGGAAAGATGG - Intronic
982965805 4:161906084-161906106 AACTAGTACTAAAGAAAGTATGG - Intronic
986927796 5:12779400-12779422 ATCAAATTCTAAGGGAAGGAAGG + Intergenic
987287807 5:16476272-16476294 TTCTGTTTTTAAAGGAAGGAGGG - Intronic
988469413 5:31524644-31524666 ATCAGGTTCTCAAAGAAGGAGGG - Intronic
988613551 5:32751415-32751437 TTCTAGTGCCAAAGGAGGGAAGG + Intronic
989158128 5:38364328-38364350 ACCTAGTTTTGAAGGAAAGAAGG + Intronic
989789575 5:45380871-45380893 TTCTAGTTTTACATGAAGGAAGG - Intronic
990640364 5:57776883-57776905 ATCTAGTTCTTAACCCAGGAAGG - Intergenic
991436630 5:66602779-66602801 TGCTAGCTCTAAAGGAATGAAGG - Intronic
991548187 5:67806749-67806771 ATCCAGATCCACAGGAAGGAAGG - Intergenic
993515228 5:88824696-88824718 ATTTAAATTTAAAGGAAGGATGG - Intronic
994758626 5:103826259-103826281 AACTAGTTCTATGGGTAGGAAGG - Intergenic
996367941 5:122722715-122722737 TTCTATTTCTAAAGGAAGATGGG - Intergenic
996377829 5:122832913-122832935 ATTTTGTTTTAAAGGAAGGGAGG + Intergenic
996820059 5:127616522-127616544 ATCTATTTCTAAGAGAAAGAAGG + Intergenic
998721172 5:144951424-144951446 ATCTGGTTTAAAATGAAGGATGG + Intergenic
998980921 5:147701358-147701380 CTCTACTTGAAAAGGAAGGAAGG + Intronic
999089194 5:148920679-148920701 ATTTAGTAGTGAAGGAAGGAAGG + Intergenic
999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG + Intergenic
1000163887 5:158628407-158628429 AAATAGTTTTGAAGGAAGGAGGG - Intergenic
1000322719 5:160147740-160147762 ATCTAGAAAGAAAGGAAGGAAGG - Intergenic
1000778260 5:165445962-165445984 ATAAAGTGCTAAGGGAAGGAGGG + Intergenic
1003801877 6:9679073-9679095 ATCTAGTTCTGAAGGAGGAAGGG - Intronic
1003829224 6:9988264-9988286 ATCTAGGCTTAAAGGATGGAAGG - Intronic
1006954390 6:37854603-37854625 ATAGAGTTCTTAAGGAAGAAAGG - Intronic
1010336941 6:74696836-74696858 ATTTATTTCTAAAGGAACAAGGG + Intergenic
1010707622 6:79133960-79133982 ATCTAGTTCTCTAGCAAGGCTGG + Intergenic
1011248657 6:85346986-85347008 TTCTAGTTGGAAAGGAAGAAGGG - Intergenic
1012306176 6:97660958-97660980 ATTCAGTTGTAAAGGAAGAAAGG - Intergenic
1012881606 6:104797704-104797726 TTCTACTTCTACAAGAAGGAGGG - Intronic
1014890724 6:126841362-126841384 ATCTAGTTATATAGGCTGGAAGG + Intergenic
1016153538 6:140774494-140774516 ATCTATTTTTAAAGGAAGGGTGG + Intergenic
1016850993 6:148618916-148618938 ATCCAATTTAAAAGGAAGGAGGG + Intergenic
1017013861 6:150084280-150084302 CAGTAGTTCTAAAGGCAGGATGG + Intergenic
1017758498 6:157549738-157549760 GTCTGATTCTAAGGGAAGGAGGG + Intronic
1018462920 6:164016405-164016427 ATGTAGTTAAAAAGGAAGAAAGG - Intergenic
1018647782 6:165963917-165963939 ATCGAGGTTTGAAGGAAGGAAGG + Intronic
1018668860 6:166163348-166163370 TTGTAGTTTTAGAGGAAGGAAGG - Intronic
1020621150 7:10520784-10520806 ATATAAATCTAAAGGAAGGCAGG + Intergenic
1022636062 7:32136653-32136675 ATTTAGTTATAAAGGCAGAAGGG + Intronic
1028285860 7:88998148-88998170 ATGTAGTTCTAAAGAAAGACAGG - Intronic
1028525903 7:91786307-91786329 CTCTACTTGAAAAGGAAGGAAGG + Intronic
1028678901 7:93502143-93502165 AACTAGTGGGAAAGGAAGGAAGG + Intronic
1029902546 7:104056931-104056953 ATCTAGGTCTAAAGGAAAGTTGG + Intergenic
1030406535 7:109121754-109121776 ATCTAGATTTAAATGAATGAAGG - Intergenic
1030478710 7:110074166-110074188 ATCTACTGCTACAGGAAGAAGGG - Intergenic
1030972464 7:116076878-116076900 ATCTAGATCTCTAGGAAGGCTGG - Intronic
1032729583 7:134625688-134625710 ATCTGATTCTACAGCAAGGATGG + Intergenic
1033883426 7:145915921-145915943 TTCTATTACTAAAGGAAGAAAGG + Intergenic
1036570057 8:9972316-9972338 ATCTAGATCTAAAGCAAGTTGGG + Intergenic
1037201389 8:16257364-16257386 ACCTAATTCTAATGGAAGGTGGG + Intronic
1038065115 8:23955887-23955909 ATATAGTGTTAAAGGAAGAAAGG + Intergenic
1038548071 8:28441403-28441425 ATGTAATTCTTAGGGAAGGAAGG - Intronic
1039327507 8:36501449-36501471 ATCTAGGAAGAAAGGAAGGAAGG + Intergenic
1040647613 8:49418294-49418316 ATCTAGTCCTCAAGCAAGAAAGG - Intergenic
1042033882 8:64508615-64508637 CTCCAGTACCAAAGGAAGGAAGG - Intergenic
1044015383 8:87044352-87044374 AACTATTTCAAAAGGAAGGAAGG - Intronic
1044705344 8:95003184-95003206 AACTGGTACCAAAGGAAGGAGGG + Intronic
1045044008 8:98257152-98257174 CCCTAATTCTAAAGGAAGGAGGG - Intronic
1049650097 8:143762299-143762321 AACTCCATCTAAAGGAAGGAAGG + Intergenic
1050776950 9:9275770-9275792 AACTTGTTCTAAAGGGAGGGAGG - Intronic
1052998504 9:34564545-34564567 GTCTGGGTCTCAAGGAAGGAGGG + Intronic
1053601501 9:39614941-39614963 CTCTACTTGTAAAGGAAGGCTGG - Intergenic
1053688384 9:40566181-40566203 TTCTATTTCTGATGGAAGGATGG + Intergenic
1053859152 9:42368722-42368744 CTCTACTTGTAAAGGAAGGCTGG - Intergenic
1053939748 9:43221657-43221679 TTCTATTTCTGATGGAAGGATGG + Intergenic
1054252032 9:62727497-62727519 CTCTACTTGTAAAGGAAGGCTGG + Intergenic
1054275646 9:63064869-63064891 TTCTATTTCTGATGGAAGGATGG - Intergenic
1054299625 9:63367092-63367114 TTCTATTTCTGATGGAAGGATGG + Intergenic
1054399187 9:64700060-64700082 TTCTATTTCTGATGGAAGGATGG + Intergenic
1054432765 9:65184326-65184348 TTCTATTTCTGATGGAAGGATGG + Intergenic
1054497620 9:65837350-65837372 TTCTATTTCTGATGGAAGGATGG - Intergenic
1054566146 9:66761998-66762020 CTCTACTTGTAAAGGAAGGCTGG + Intergenic
1055594942 9:77856383-77856405 ATATATTTCTATAGGAAGGAAGG + Intronic
1056256831 9:84808066-84808088 ATCTACTTCTTTGGGAAGGATGG + Intronic
1062677980 9:137759508-137759530 AGGTAGCTCTAAAGGAAGGATGG + Intronic
1203653879 Un_KI270752v1:5016-5038 AACTATGTCTTAAGGAAGGAAGG - Intergenic
1186627207 X:11307044-11307066 CTCTGGTTCCAAAGGATGGATGG + Intronic
1187419768 X:19123519-19123541 TTCTAGTTGTAAAGGAAAAATGG - Intergenic
1188650162 X:32622563-32622585 ATTTTGTCCTATAGGAAGGAAGG - Intronic
1189394271 X:40606782-40606804 ATTTAGTACTAATGTAAGGAAGG + Intergenic
1190432019 X:50387370-50387392 ATCTTTTGCTAAATGAAGGATGG - Intronic
1192612742 X:72584251-72584273 CTCTAGTGGTAGAGGAAGGAAGG + Exonic
1194546897 X:95247242-95247264 ATATACTTCTAAAAGAATGAAGG - Intergenic
1198021374 X:132661741-132661763 AACAAGTTATAAAGGAAGAATGG + Intronic
1200740607 Y:6849940-6849962 CTCTGGTTCCAAAGGATGGATGG - Intergenic
1201613007 Y:15864197-15864219 ATCCAGCTCTAAATTAAGGAAGG + Intergenic