ID: 940806026

View in Genome Browser
Species Human (GRCh38)
Location 2:158187355-158187377
Sequence ACTTATTCAAATGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940806017_940806026 11 Left 940806017 2:158187321-158187343 CCACCTTCCATGGTTCTCTTTCC No data
Right 940806026 2:158187355-158187377 ACTTATTCAAATGGGGTGGAGGG No data
940806016_940806026 15 Left 940806016 2:158187317-158187339 CCAACCACCTTCCATGGTTCTCT No data
Right 940806026 2:158187355-158187377 ACTTATTCAAATGGGGTGGAGGG No data
940806020_940806026 -10 Left 940806020 2:158187342-158187364 CCTCTACGTACAAACTTATTCAA No data
Right 940806026 2:158187355-158187377 ACTTATTCAAATGGGGTGGAGGG No data
940806019_940806026 4 Left 940806019 2:158187328-158187350 CCATGGTTCTCTTTCCTCTACGT No data
Right 940806026 2:158187355-158187377 ACTTATTCAAATGGGGTGGAGGG No data
940806018_940806026 8 Left 940806018 2:158187324-158187346 CCTTCCATGGTTCTCTTTCCTCT No data
Right 940806026 2:158187355-158187377 ACTTATTCAAATGGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940806026 Original CRISPR ACTTATTCAAATGGGGTGGA GGG Intronic
No off target data available for this crispr