ID: 940807146

View in Genome Browser
Species Human (GRCh38)
Location 2:158200481-158200503
Sequence CTGTCAATATGTAAGCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940807146_940807148 3 Left 940807146 2:158200481-158200503 CCCATTTGCTTACATATTGACAG No data
Right 940807148 2:158200507-158200529 TGAGAAGCTGTGACAGAGACAGG No data
940807146_940807149 7 Left 940807146 2:158200481-158200503 CCCATTTGCTTACATATTGACAG No data
Right 940807149 2:158200511-158200533 AAGCTGTGACAGAGACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940807146 Original CRISPR CTGTCAATATGTAAGCAAAT GGG (reversed) Intronic
No off target data available for this crispr