ID: 940810812

View in Genome Browser
Species Human (GRCh38)
Location 2:158240766-158240788
Sequence CTGTAGGAATTGCAGGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940810812_940810819 20 Left 940810812 2:158240766-158240788 CCCATATCCTGCAATTCCTACAG No data
Right 940810819 2:158240809-158240831 TTAAAGGCCTCAATGGAAACAGG No data
940810812_940810816 4 Left 940810812 2:158240766-158240788 CCCATATCCTGCAATTCCTACAG No data
Right 940810816 2:158240793-158240815 CACACGCCTGCAACAATTAAAGG No data
940810812_940810818 13 Left 940810812 2:158240766-158240788 CCCATATCCTGCAATTCCTACAG No data
Right 940810818 2:158240802-158240824 GCAACAATTAAAGGCCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940810812 Original CRISPR CTGTAGGAATTGCAGGATAT GGG (reversed) Intronic
No off target data available for this crispr