ID: 940816326

View in Genome Browser
Species Human (GRCh38)
Location 2:158301767-158301789
Sequence CTCTTCCATCCTGATCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940816326_940816334 22 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816334 2:158301812-158301834 GTGGTCACTGGAGACCTTAAGGG No data
940816326_940816330 0 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816330 2:158301790-158301812 CCTTGCTGGATTAGGTAATACGG No data
940816326_940816333 21 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816333 2:158301811-158301833 GGTGGTCACTGGAGACCTTAAGG No data
940816326_940816332 10 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816332 2:158301800-158301822 TTAGGTAATACGGTGGTCACTGG No data
940816326_940816328 -8 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816328 2:158301782-158301804 TGGAAGAGCCTTGCTGGATTAGG No data
940816326_940816335 23 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816335 2:158301813-158301835 TGGTCACTGGAGACCTTAAGGGG No data
940816326_940816331 3 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816331 2:158301793-158301815 TGCTGGATTAGGTAATACGGTGG No data
940816326_940816336 26 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816336 2:158301816-158301838 TCACTGGAGACCTTAAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940816326 Original CRISPR CTCTTCCATCCTGATCCTCC TGG (reversed) Intronic
No off target data available for this crispr