ID: 940816328

View in Genome Browser
Species Human (GRCh38)
Location 2:158301782-158301804
Sequence TGGAAGAGCCTTGCTGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940816326_940816328 -8 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816328 2:158301782-158301804 TGGAAGAGCCTTGCTGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940816328 Original CRISPR TGGAAGAGCCTTGCTGGATT AGG Intronic
No off target data available for this crispr