ID: 940816329

View in Genome Browser
Species Human (GRCh38)
Location 2:158301790-158301812
Sequence CCGTATTACCTAATCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940816329_940816334 -1 Left 940816329 2:158301790-158301812 CCTTGCTGGATTAGGTAATACGG No data
Right 940816334 2:158301812-158301834 GTGGTCACTGGAGACCTTAAGGG No data
940816329_940816336 3 Left 940816329 2:158301790-158301812 CCTTGCTGGATTAGGTAATACGG No data
Right 940816336 2:158301816-158301838 TCACTGGAGACCTTAAGGGGTGG No data
940816329_940816333 -2 Left 940816329 2:158301790-158301812 CCTTGCTGGATTAGGTAATACGG No data
Right 940816333 2:158301811-158301833 GGTGGTCACTGGAGACCTTAAGG No data
940816329_940816335 0 Left 940816329 2:158301790-158301812 CCTTGCTGGATTAGGTAATACGG No data
Right 940816335 2:158301813-158301835 TGGTCACTGGAGACCTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940816329 Original CRISPR CCGTATTACCTAATCCAGCA AGG (reversed) Intronic
No off target data available for this crispr