ID: 940816336

View in Genome Browser
Species Human (GRCh38)
Location 2:158301816-158301838
Sequence TCACTGGAGACCTTAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940816329_940816336 3 Left 940816329 2:158301790-158301812 CCTTGCTGGATTAGGTAATACGG No data
Right 940816336 2:158301816-158301838 TCACTGGAGACCTTAAGGGGTGG No data
940816326_940816336 26 Left 940816326 2:158301767-158301789 CCAGGAGGATCAGGATGGAAGAG No data
Right 940816336 2:158301816-158301838 TCACTGGAGACCTTAAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940816336 Original CRISPR TCACTGGAGACCTTAAGGGG TGG Intronic
No off target data available for this crispr