ID: 940824043

View in Genome Browser
Species Human (GRCh38)
Location 2:158389953-158389975
Sequence GGTACATACATATTGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940824043_940824044 -7 Left 940824043 2:158389953-158389975 CCATGCTTCAATATGTATGTACC No data
Right 940824044 2:158389969-158389991 ATGTACCTTTTTACTGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940824043 Original CRISPR GGTACATACATATTGAAGCA TGG (reversed) Intronic
No off target data available for this crispr