ID: 940829196

View in Genome Browser
Species Human (GRCh38)
Location 2:158449164-158449186
Sequence CAGTTGTATTTTTATATGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940829196_940829198 30 Left 940829196 2:158449164-158449186 CCTAGCATATAAAAATACAACTG No data
Right 940829198 2:158449217-158449239 CCTTGTTAAATTCATTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940829196 Original CRISPR CAGTTGTATTTTTATATGCT AGG (reversed) Intronic
No off target data available for this crispr