ID: 940830250

View in Genome Browser
Species Human (GRCh38)
Location 2:158457715-158457737
Sequence GGGGCGTGGGAAGACGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1001
Summary {0: 1, 1: 0, 2: 1, 3: 71, 4: 928}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940830250_940830257 -9 Left 940830250 2:158457715-158457737 CCCTCCCCGTCTTCCCACGCCCC 0: 1
1: 0
2: 1
3: 71
4: 928
Right 940830257 2:158457729-158457751 CCACGCCCCTGCTGCCCGCGCGG 0: 1
1: 0
2: 3
3: 24
4: 200
940830250_940830266 29 Left 940830250 2:158457715-158457737 CCCTCCCCGTCTTCCCACGCCCC 0: 1
1: 0
2: 1
3: 71
4: 928
Right 940830266 2:158457767-158457789 CGAAGTCCTGTACTCCTTGCCGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940830250 Original CRISPR GGGGCGTGGGAAGACGGGGA GGG (reversed) Intronic
900156845 1:1206610-1206632 AGGGCGGGTGAGGACGGGGACGG - Intronic
900281974 1:1875749-1875771 GGGGAATGGGAAGACATGGAAGG + Intronic
900327208 1:2114177-2114199 GTGGCCTGGGAGGACGTGGAAGG + Intronic
900785078 1:4644337-4644359 GAGGCGTGGGATGGCAGGGAGGG + Intergenic
900785092 1:4644373-4644395 GGGGTGTGGGATGGCAGGGAAGG + Intergenic
900785104 1:4644410-4644432 GGGGGGTGGGATGACAGGGAGGG + Intergenic
901065065 1:6490521-6490543 GGCGCGCGGGGAGAGGGGGACGG + Intronic
902690481 1:18107707-18107729 GGGGGGCGGGGAGAGGGGGAGGG + Intergenic
902768160 1:18630576-18630598 GGGGCTGGGGGAGAAGGGGAGGG - Intergenic
903455492 1:23484223-23484245 GGGGCGTGTGGAGGCCGGGACGG - Intronic
904069734 1:27784914-27784936 GGGGGGTGGAAAGATAGGGAGGG - Intronic
904533719 1:31185356-31185378 GGGGCCTGGGGAGTGGGGGATGG + Intronic
904686827 1:32266703-32266725 GGGGAGGGGGAGGAGGGGGAAGG - Intronic
905006948 1:34717507-34717529 GGGGGGTGGGGAGAAGGGAAGGG - Intronic
905107907 1:35574882-35574904 GGGGCTTGGGAAGACATGGGCGG + Intronic
905123738 1:35702555-35702577 GGGGCTGGGGGAGACGGGGGAGG + Intergenic
905462910 1:38133233-38133255 GGGGATGGGGAAGAAGGGGAGGG + Intergenic
905470525 1:38188291-38188313 TGGGCGTGGGAGGAGGAGGAGGG + Intergenic
905526187 1:38641794-38641816 GGGGAGTCGGAAGTGGGGGATGG + Intergenic
905533185 1:38698506-38698528 GGGACGTGTGAAGAAGAGGAAGG - Intergenic
905656005 1:39686477-39686499 GGGTCGTGGAGAGACGTGGATGG + Intronic
906471271 1:46132988-46133010 GGGGCGAGGGAAGAGAGGCAAGG + Intronic
907178320 1:52546518-52546540 GGGGTGAGGGAAGAAGGGAACGG + Intronic
907328228 1:53654603-53654625 GGGGACTGGGAAGAAGCGGAGGG + Intronic
907645900 1:56243144-56243166 GTGGGGTGGGGAGACGGGGGAGG - Intergenic
908201502 1:61800721-61800743 GTGGGGTGGGAAGAAGGGGAGGG - Intronic
908556291 1:65259789-65259811 GAGGGGTGGGAGGATGGGGAGGG + Intronic
908778411 1:67665316-67665338 GTGGGGTGGGGAGAGGGGGAAGG - Intergenic
909046828 1:70720613-70720635 GGAGGGAGGGAAGACAGGGAGGG - Intergenic
909380520 1:74992464-74992486 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
910210050 1:84783333-84783355 GGGGCGGGGTAAGATGGGGCAGG - Intergenic
910665885 1:89725742-89725764 TGGGAGGGGGAAGATGGGGATGG - Intronic
911098923 1:94078563-94078585 GGGGGGTTGGAGGATGGGGAGGG - Intronic
911820325 1:102411279-102411301 GGGGGGTGGGGGGAGGGGGAGGG + Intergenic
911995188 1:104758024-104758046 GGGGATGGGGAAGAGGGGGATGG + Intergenic
912058369 1:105632971-105632993 GGGGCGTGGGAGGAAAGGCAGGG + Intergenic
912081946 1:105948031-105948053 GTGGGGTGGGGAGAGGGGGAGGG - Intergenic
912135818 1:106659208-106659230 GGGGAGTGAGAAGAATGGGAAGG + Intergenic
912763555 1:112389023-112389045 GAGGGGTGGGAAGAGAGGGAAGG + Intergenic
912867605 1:113271948-113271970 GGGACTTGGGAAGAGTGGGAGGG - Intergenic
913387949 1:118280117-118280139 GGAGGTGGGGAAGACGGGGAGGG - Intergenic
913454718 1:119019290-119019312 GGGGAGCTGGAAGAAGGGGATGG - Intergenic
913519535 1:119631865-119631887 GGGGCGTGGGAAGAGGAGGGAGG - Intronic
914196813 1:145451972-145451994 GGGGAGGGGGAAGAAGGGGAGGG + Intergenic
914454876 1:147826636-147826658 GAAGCGTGGGAAGAGGGTGAGGG - Intergenic
915274574 1:154779374-154779396 GTGGAGTGGGAAGGTGGGGACGG - Intronic
915495903 1:156282550-156282572 GGGAAGTGGGGAGACGGCGAGGG - Intronic
915799439 1:158773661-158773683 TGGGGGAGGGAAGATGGGGAGGG - Intergenic
915927259 1:160032122-160032144 GGGGCGCGGGAAGAGGGCGGGGG - Intergenic
916793656 1:168146125-168146147 GGGGTGGGGAAGGACGGGGAGGG + Intergenic
917025004 1:170631814-170631836 GGGACTGGGGACGACGGGGATGG - Intergenic
917579604 1:176361833-176361855 GGGGGGTGGGGAGAGGGGGGAGG + Intergenic
917628775 1:176872822-176872844 GTGGCTTGGGAAGAAGGTGAGGG - Intronic
917755174 1:178091815-178091837 GGGGCGTGGGGGAAAGGGGAGGG + Intergenic
918015908 1:180632285-180632307 GGGGTGTGGGAGGACTCGGAGGG + Intronic
918045903 1:180940998-180941020 GGGGCGGGGGAGGGCCGGGAGGG - Intronic
918088984 1:181271511-181271533 GGCGGGAGGGAAGAAGGGGAAGG - Intergenic
918679507 1:187334118-187334140 GTGGGGTGGGGAGACGGGGGAGG + Intergenic
918794461 1:188874581-188874603 GGGGAGCCGGAAGAGGGGGATGG + Intergenic
918980112 1:191546471-191546493 GGGAGGTAGGAAGAGGGGGAAGG + Intergenic
919638245 1:200024797-200024819 GGGGCGAGGGGAGGAGGGGAGGG + Intergenic
919841694 1:201614035-201614057 GGGGGTTGGGAAGATGGGGCTGG + Intergenic
919942462 1:202297711-202297733 GGGGCTTGGGGAGCCGGGGCGGG - Intronic
920487102 1:206381204-206381226 GGGATGGGGGAAGAAGGGGAGGG - Intronic
921177382 1:212607103-212607125 CGGGCCTGGGAACACGCGGAGGG - Intronic
921771950 1:219050654-219050676 GGGGAGTGAAAAGAAGGGGAGGG + Intergenic
922768083 1:228166260-228166282 GGGGGGTGGGCACCCGGGGAGGG + Intronic
922857812 1:228790163-228790185 GGGGCGAAGGTAGACTGGGATGG + Intergenic
923482408 1:234397379-234397401 GCGGAGGGGGAGGACGGGGATGG + Intronic
923482555 1:234397680-234397702 GAGGTGAGGGAAGAGGGGGAGGG + Intronic
923482611 1:234397797-234397819 GAGGCGGGGGAAGAGGGGGAGGG + Intronic
923595882 1:235360669-235360691 GGGGCTTGGGCAGATGGGGGAGG - Intergenic
923784499 1:237054314-237054336 GGGGAGGGGGGAGGCGGGGAGGG - Intronic
924289665 1:242524531-242524553 GGGGCGGGGGCGGAGGGGGACGG + Intronic
924457767 1:244231812-244231834 TGGGGGTGGGAGGAAGGGGACGG - Intergenic
1062797932 10:358597-358619 GGGGGGTGGGAGGTGGGGGACGG + Intronic
1062824513 10:557887-557909 GGGGCAGGGGCAGGCGGGGAAGG + Intronic
1063266588 10:4458216-4458238 GGAGGGTGGGAGGACGGTGAGGG - Intergenic
1063685726 10:8235731-8235753 GGGGGGTGGGAAGGGGGGGCGGG + Intergenic
1064106205 10:12502732-12502754 GGGGCGTGGAGAGAGGGTGAAGG + Intronic
1064655675 10:17553218-17553240 GGGGAATGGGAAGAGGGCGATGG - Intergenic
1064872431 10:19953304-19953326 GGGACGTGGAATGAAGGGGAAGG + Intronic
1065177697 10:23095439-23095461 GGGGAGGGAGAAGAGGGGGAGGG + Intergenic
1065590402 10:27256848-27256870 GGAGCGGGGGAAGAGGGGGTGGG - Intergenic
1065599756 10:27356588-27356610 GGGGCGTAGGAGGACTGGGTGGG + Intergenic
1065647357 10:27849401-27849423 GTGGGGTGGGAGGAGGGGGAGGG + Intronic
1066436451 10:35400331-35400353 GGGGAGGGGGAAAACAGGGAGGG - Intronic
1066504789 10:36029625-36029647 GGGGTGGGGGGAGAGGGGGAGGG + Intergenic
1066805716 10:39250683-39250705 GTGGAGTGGGAAGAGGGGGAGGG - Intergenic
1067354292 10:45511389-45511411 GGGCCGTGGGGAGAGGGAGAGGG - Intronic
1067693107 10:48517059-48517081 GGGACGAGGGGACACGGGGAGGG + Intronic
1067701632 10:48577428-48577450 GTGGCGTCGGAGGATGGGGAGGG + Intronic
1068652142 10:59534201-59534223 GGGGGGTGGGGAGTGGGGGAGGG + Intergenic
1069588886 10:69630090-69630112 GGGGCGTGGGAAGGAGTGGGAGG - Intergenic
1069666312 10:70162470-70162492 GGGGCAGGGGAGGAGGGGGAGGG + Intronic
1069721854 10:70554920-70554942 GGGGAGGGGGAGGAGGGGGAGGG - Intronic
1069753400 10:70759331-70759353 GGGAGGTGGGAAGAGTGGGAGGG - Intronic
1069963772 10:72096421-72096443 GGGGCATGGGAAGATGAGGGTGG + Intronic
1070156690 10:73839779-73839801 GGGGCCTGGGAAGACCGGGCTGG + Intronic
1070282150 10:75057865-75057887 GGGGCAGGGGAAGTCTGGGATGG + Intronic
1070447702 10:76523605-76523627 GGGGGGTGGGAAGGGAGGGATGG + Intronic
1070735423 10:78860735-78860757 GGAGAATGGGAAGAAGGGGAGGG + Intergenic
1070780760 10:79136253-79136275 GGAGGGTGGGGAGAGGGGGAAGG - Intronic
1070968181 10:80542801-80542823 GGAGAGTGGGAAGAGCGGGAGGG - Intronic
1071044380 10:81355793-81355815 GTGGGGTGGGAGGACGGGGGAGG + Intergenic
1071415149 10:85434133-85434155 GGGTTGTGGGAGGATGGGGAGGG - Intergenic
1071499694 10:86194690-86194712 GGGGAGTGGGAAGATGTGGAAGG - Intronic
1071785940 10:88899868-88899890 GGGGAATGTGAAGCCGGGGAGGG - Intronic
1072321635 10:94255963-94255985 GGGGCGTGGGGAGAGAGGGAGGG - Intronic
1072742535 10:97918123-97918145 GCGGGGTGGGAACAGGGGGAGGG - Intronic
1072766592 10:98099406-98099428 GGGCCCTGGGAACACAGGGATGG - Intergenic
1073126819 10:101155990-101156012 GGGGCTGGGGAAGATGGGGGTGG + Intergenic
1073204093 10:101759570-101759592 GGGTCGGGGGAAGAGGGGAAGGG + Intergenic
1073207370 10:101776164-101776186 GGGAGGTGGGAGGGCGGGGAGGG + Intronic
1073240753 10:102056197-102056219 GGGGCGCGGGGACACGGGAAGGG - Intergenic
1073491530 10:103855829-103855851 GGGGCTCGGGGCGACGGGGAGGG + Intergenic
1074524671 10:114253248-114253270 GAGGAGGGGGGAGACGGGGACGG - Intronic
1075585448 10:123653817-123653839 GGGGAGGGGGAAGAGGAGGAAGG + Intergenic
1076320614 10:129578532-129578554 GTGGGGTGGGAGGAGGGGGAGGG + Intronic
1076364975 10:129915896-129915918 GGCCCCTGGGGAGACGGGGAGGG + Intronic
1076848934 10:133083570-133083592 CTGGCGAGGGAAGACGGGGCTGG + Intronic
1076879815 10:133234699-133234721 GGGGCGTGGGGTGTCGGTGAGGG + Intergenic
1077008302 11:369349-369371 GGGGCGAGGGGAGGCGGGGCGGG - Intergenic
1077008324 11:369397-369419 GGGGCGCGGGAAGGCGGGGCGGG - Intergenic
1077018484 11:407199-407221 GGGGCGGGGGAGGGCGGGGCCGG + Intronic
1077087787 11:763264-763286 GGGGCGGGTGAGGGCGGGGACGG - Intronic
1077289570 11:1782641-1782663 GGGGCAGGGAAAGACGTGGAGGG - Intergenic
1077318441 11:1929432-1929454 GGGGCTTGGGAGAAAGGGGAGGG - Intronic
1077368490 11:2170818-2170840 AGGGCGGGGGAGGACGGGGGAGG + Intronic
1077423351 11:2463092-2463114 GGGGAGTGGGAAGTGGGGGACGG + Intronic
1077499305 11:2902068-2902090 GGGGCGGGCGAAGCCGGGCACGG + Intronic
1077610757 11:3642055-3642077 GGGGTGTGGGGAGTCGGGGGCGG - Exonic
1077700930 11:4441789-4441811 GGGACTTGGGAAGAGTGGGAGGG + Intergenic
1079251945 11:18793001-18793023 GGAGCGTGGGAGAAGGGGGAGGG - Intergenic
1079298030 11:19252110-19252132 GGGCAGTGGGAGGTCGGGGAAGG - Intergenic
1079311126 11:19366837-19366859 TGAGAGTGGGAGGACGGGGAAGG - Intronic
1079810714 11:24996760-24996782 GTGGGGTGGGGAGAGGGGGAGGG - Intronic
1080749873 11:35141675-35141697 GGGCCGTGGAAACACGGGGCAGG - Intronic
1081196917 11:40172545-40172567 GGAGCATGGGAAGAATGGGAGGG - Intronic
1081608772 11:44545817-44545839 AAGGCTTGGGGAGACGGGGATGG + Intergenic
1081854684 11:46296005-46296027 CGGGGGTGGGAAGCCGGAGAAGG - Intronic
1081870766 11:46381628-46381650 GGGGGGTGGGGAGAGGGGGCGGG + Intronic
1081931664 11:46875753-46875775 GGAGCCTGGGAAGATGGGAAAGG - Intronic
1082102587 11:48185494-48185516 GTGGGGTGGGGAGAGGGGGAAGG - Intergenic
1083335442 11:61919137-61919159 GGGGCTTGTGAAGACTTGGAGGG - Intronic
1083802074 11:65052662-65052684 GGGTTGTGGGAAGCCGGTGAAGG - Intronic
1084013706 11:66366567-66366589 GGGGTGAGGGGGGACGGGGAAGG + Intronic
1084070006 11:66728016-66728038 GGGGCGGGAGCAGGCGGGGACGG - Intronic
1084187831 11:67484202-67484224 GTGGCGTTGGAAGAAGGGGCTGG + Intronic
1084271220 11:68030359-68030381 GGGGCGTGTGATGACGGTAATGG - Intergenic
1084355378 11:68634848-68634870 GGGGCGTGGAAATAAGGGGTTGG - Intergenic
1085294166 11:75421272-75421294 GGGGCTTTGGAAGATGGGGTGGG + Intronic
1085537896 11:77236325-77236347 GTGGGGTGGGGAGACGGGGCAGG - Intronic
1085676560 11:78525662-78525684 GGGGTTTGGGAAGAGGGAGATGG - Intronic
1086033543 11:82388850-82388872 GGGGAGTGGGAAAGTGGGGATGG + Intergenic
1086246613 11:84760900-84760922 GGGGAGCAGGAAGAGGGGGATGG - Intronic
1086549090 11:88033226-88033248 GTGGCGTGGGAGGAGGGGGGAGG + Intergenic
1086641406 11:89161647-89161669 GGGGTGTGGGAGAGCGGGGAGGG - Intergenic
1086827730 11:91519857-91519879 GGGTCGGGGGAAGGGGGGGAAGG - Intergenic
1088621628 11:111690601-111690623 GGGGTGAGGGGAGGCGGGGAGGG - Intronic
1088884920 11:113998975-113998997 GGGTGGTGGGGTGACGGGGAGGG - Intergenic
1089366438 11:117923684-117923706 GGGGAGTGGGGAGACGGGGGAGG + Intronic
1090262189 11:125329748-125329770 GGGGAGTGGGAAGTTGTGGACGG + Intronic
1090400791 11:126447146-126447168 GGGGCCTGGGAAGAAGGTGCTGG + Intronic
1090656935 11:128853491-128853513 GGGGCTGGGGAAGAGGCGGATGG + Intronic
1090697558 11:129263608-129263630 GGGGAGCGGGGAGAGGGGGAGGG + Intronic
1090950214 11:131466215-131466237 GAGGAGTGGGAAGACGGAGAAGG + Intronic
1202828129 11_KI270721v1_random:99625-99647 GGGGCGCGGGAAATCGGAGAGGG + Intergenic
1091404271 12:199154-199176 GGGGAGGAGGAAGACAGGGAGGG + Intronic
1091408517 12:223966-223988 AGGGCCTGGGAAGCGGGGGAAGG - Intronic
1091493582 12:952982-953004 GGGGAGGGGGGAGAGGGGGAGGG + Intronic
1091695424 12:2625083-2625105 GGGGCGGGGGGAGCGGGGGAAGG - Intronic
1091707427 12:2705478-2705500 GTGGGGTGGGAAGAGGGGGGAGG + Intergenic
1091818094 12:3454550-3454572 GGGGCCAGGGAAGACGGGGCGGG + Intronic
1092144253 12:6203684-6203706 GGGGGGTGGGCAGGCGGGCAGGG - Intronic
1092944191 12:13437792-13437814 GGGAGGGGGGAAGAGGGGGAGGG + Intergenic
1093384550 12:18535959-18535981 GGGGTGGGGGAAGAGGGGTAGGG + Intronic
1093712191 12:22339969-22339991 GGGGAGCTGGAAGAGGGGGATGG - Intronic
1094083418 12:26562767-26562789 GGGGTGGGGGAAGGGGGGGAGGG + Intronic
1094115201 12:26903809-26903831 GGGGTGGGGGAACAAGGGGAAGG + Intergenic
1094339358 12:29393354-29393376 GGGGCGGGGGAAGCGGGGGTGGG + Intergenic
1095668837 12:44834957-44834979 AGGGGGTGGGAAGAAGGGCAGGG + Intronic
1095788859 12:46142884-46142906 GAGGGGAGGGAAGACTGGGAAGG - Intergenic
1095977473 12:47949618-47949640 GGGGCGTGGGAGGCCTGGGCCGG - Intergenic
1095983209 12:47984281-47984303 GGGGCCTGGGAAGGAAGGGAGGG - Intronic
1095991395 12:48036997-48037019 GGGGCGTGGGAGGTGGAGGATGG + Intergenic
1096010535 12:48210339-48210361 GTGGGGTGGGGAGGCGGGGAGGG + Intergenic
1096111998 12:49034379-49034401 GGGGCGTGGGAGGAAGGTGCAGG - Intronic
1096609427 12:52791175-52791197 GGGGTGTGGGAAGACGGGACTGG + Intronic
1096700724 12:53380752-53380774 GGGGCGTGGAAAGGGCGGGACGG - Intronic
1097007665 12:55931017-55931039 TGGGGGTGGGAAGAAGGGGGAGG - Exonic
1097503420 12:60434755-60434777 GTGGGGTGGGAAGCGGGGGAGGG + Intergenic
1098337706 12:69420805-69420827 GGGGGCTGGGAGGCCGGGGATGG - Intergenic
1099628071 12:85102246-85102268 GTGGGGTGGGAAGACATGGAGGG - Intronic
1099892133 12:88602945-88602967 GGGGGGTGGGGGGAGGGGGAAGG - Intergenic
1100754002 12:97729716-97729738 GGGGGGAGGGGGGACGGGGAGGG + Intergenic
1100789162 12:98111604-98111626 GGGGGGTGGGGGGAGGGGGAAGG - Intergenic
1101283767 12:103287554-103287576 GTGGGGTGGGGAGAGGGGGAAGG + Intronic
1101761839 12:107665076-107665098 GGGGGGTGGGAGCAAGGGGAGGG + Intergenic
1101909292 12:108850180-108850202 TGGGGGAGGGAAGATGGGGAGGG + Intronic
1102004250 12:109578926-109578948 GGTGCCTGGGCAGAAGGGGAAGG - Intronic
1102392229 12:112558477-112558499 GTGGTGGGGGAAGGCGGGGAAGG - Intergenic
1102937494 12:116910222-116910244 GGAGGGTGGGAAGGTGGGGAGGG - Intergenic
1102962152 12:117099660-117099682 GGGGCGTGGGTAGGAGGGGTGGG + Intergenic
1103244050 12:119440061-119440083 GGGGGGTGGGGGGCCGGGGATGG + Intronic
1103425517 12:120830404-120830426 GGGGAGGGGGAAGAAGGGGGAGG + Intronic
1103425532 12:120830432-120830454 GGGGAGGGGGAAGAAGGGGGAGG + Intronic
1103425564 12:120830490-120830512 GGGAGGGGGGAAGAAGGGGAGGG + Intronic
1103741855 12:123096507-123096529 AGGCAGTGGGAAGATGGGGAGGG + Intronic
1104415069 12:128591268-128591290 GGGGCTGGGGGAGGCGGGGAGGG - Intronic
1104956830 12:132470824-132470846 GGGGAGGGGAAAGAAGGGGAGGG + Intergenic
1104971017 12:132530727-132530749 GGGGGGTGGGGGGAGGGGGAAGG + Intronic
1105007385 12:132729625-132729647 GGGGGGAGGGAAGGTGGGGAAGG + Intronic
1105319966 13:19310089-19310111 GGGGAGAGGGAAAGCGGGGATGG - Intergenic
1105659530 13:22478182-22478204 GGGGGGTGGGGGGAGGGGGAGGG + Intergenic
1105763471 13:23534491-23534513 CAGGCTTGGGAAGACGGAGAAGG + Intergenic
1106158508 13:27179621-27179643 GGGACTTGGGAAGAAGGGCAGGG + Intergenic
1106193691 13:27475769-27475791 GGGGCTGGGGAAGGCGGGAATGG - Intergenic
1106231351 13:27823555-27823577 GGGGCCTGGGGAGATGGGGAGGG + Intergenic
1106308219 13:28532268-28532290 GGGGCGCGGGATGAAGGGGGTGG - Intergenic
1106351148 13:28931820-28931842 GTGGGGTGGGGAGGCGGGGAGGG - Intronic
1107220463 13:37973754-37973776 GGGGCATGGAAATACGGGGTTGG + Intergenic
1107414919 13:40191579-40191601 TGGGGGTTGGAAGAAGGGGAGGG - Intergenic
1107794546 13:44036630-44036652 GGGGTGGGGGAAGTGGGGGAGGG - Intergenic
1107805921 13:44153886-44153908 GAGGCCTGGGAGGAAGGGGAAGG - Intronic
1107919458 13:45189044-45189066 GTGGGGTGGGGAGCCGGGGAGGG - Intronic
1108132406 13:47316771-47316793 GGGGGGTGGGGAGAAGGGGAGGG + Intergenic
1108300476 13:49069407-49069429 GGGGTGGGGGAACACGGGAAGGG - Intronic
1109060980 13:57619994-57620016 GTGGGGTGGGGAGACGGGGGAGG + Intergenic
1109162827 13:58997350-58997372 GGGGGGTGGGAGGAGGGGGGAGG - Intergenic
1110318662 13:74135739-74135761 GGGCTGTGGGAAGGCCGGGAAGG + Intergenic
1110428148 13:75392595-75392617 GAGGAGGGGGAAGAAGGGGAGGG - Intronic
1110513569 13:76382186-76382208 GGGGTGGGGGAAGGCGGGGAGGG + Intergenic
1111654202 13:91131981-91132003 GGGGCGGGGGAAGCAGGAGAGGG + Intergenic
1111793792 13:92891574-92891596 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
1111823047 13:93236370-93236392 GGAGGGTGGGAAGAGGGTGAGGG - Intronic
1112303042 13:98247564-98247586 GGGAGGAGGGAAGACGGAGAAGG + Intronic
1112337840 13:98529160-98529182 GGGGCCTGGGGAGAGGGAGACGG - Intronic
1113588858 13:111484141-111484163 GGGGCGGGGGTAGAGGAGGACGG + Intergenic
1113768261 13:112894122-112894144 GAGGAGGGGGAAGAGGGGGATGG + Intergenic
1113909929 13:113836863-113836885 GGGGAGTGGGGAGAGGAGGAGGG + Intronic
1114510148 14:23252094-23252116 GGGGCGTGGGAAGAAAGGTTGGG + Intronic
1114522835 14:23349554-23349576 GAGGCTTGAGAAGATGGGGAGGG + Intronic
1115362851 14:32523178-32523200 GGGGTGGGGGAAGGGGGGGAGGG + Intronic
1115498219 14:34027308-34027330 GGGAAGGGGGAAGAAGGGGAGGG + Intronic
1115498279 14:34027426-34027448 GGGGAGGGGGAAGAAGGGGAGGG + Intronic
1115498299 14:34027477-34027499 GGGAGGGGGGAAGAAGGGGAGGG + Intronic
1115498316 14:34027512-34027534 AGGGAGGGGGAAGAAGGGGAGGG + Intronic
1115498323 14:34027527-34027549 GGGGAGGGGGAAGAAGGGGAGGG + Intronic
1116426600 14:44798919-44798941 GGGGAGCGGGGAGGCGGGGACGG - Intergenic
1116689084 14:48081467-48081489 GGGGGGTGGGGGGAGGGGGAGGG + Intergenic
1117688530 14:58280533-58280555 GGGGGGTGGGGGGAAGGGGAGGG + Intronic
1118171841 14:63395896-63395918 GGGGAGCGGGAAGATGGGGGAGG + Intronic
1118171888 14:63396025-63396047 GGGGAGGGGGAAGATGGGGGAGG + Intronic
1118404989 14:65413418-65413440 GGGGCGCGGGCAGAGGGTGAGGG + Intronic
1118640399 14:67787053-67787075 GGGGTGGGGGAAGATGGAGATGG + Intronic
1119380891 14:74227494-74227516 GGGGCTAAGGAAGAAGGGGAAGG + Intergenic
1119573344 14:75695816-75695838 TGGGAGAGGGAAGTCGGGGAGGG - Intronic
1119595178 14:75926078-75926100 GGGCCGTGGGGAGAGGGAGAGGG + Intronic
1119725684 14:76920648-76920670 GGGGTGGGGGATGACAGGGAGGG - Intergenic
1119773658 14:77236098-77236120 GGGGCATGGGGAGACTGTGATGG + Intronic
1120822742 14:88928155-88928177 GGGGCAGGGACAGACGGGGAGGG - Intergenic
1121168910 14:91836576-91836598 GAGGCGAGGCAAGGCGGGGAGGG + Intronic
1121168918 14:91836596-91836618 GGGGCGAGGCAAGGCGGGGAGGG + Intronic
1121274061 14:92656071-92656093 AGGGCATGGGAGGACGTGGAAGG + Intronic
1121660982 14:95634916-95634938 GGAGCCTGGAAAGACGGAGAAGG - Intergenic
1121751776 14:96363477-96363499 GGGGCGGAAGAAGGCGGGGAGGG + Exonic
1122953069 14:105056548-105056570 GAGCCGTAGGAAGTCGGGGAGGG - Intronic
1123696631 15:22883426-22883448 GTGGAGTGGGAAGGCGAGGAAGG + Intronic
1124611443 15:31212221-31212243 GGAGGGAGGGAAGACAGGGAGGG + Intergenic
1124730072 15:32189412-32189434 GGGGTGGGGGAAGGGGGGGAGGG + Intergenic
1125183470 15:36904302-36904324 TGGGGGTGGGAGGAAGGGGAGGG - Intronic
1125688976 15:41581276-41581298 GGAGTGTGGGGAGACTGGGAGGG + Exonic
1126467907 15:48977236-48977258 GGAGGGTGGGAAGCTGGGGAAGG - Intergenic
1127547279 15:60003304-60003326 GGGGGGTGGGAGGGCTGGGAAGG + Intergenic
1127783151 15:62333317-62333339 GGGCCGTGGGGAGAGGGAGAGGG + Intergenic
1127916233 15:63457847-63457869 GGGGGGCGGGGAGAGGGGGAGGG + Intergenic
1128129317 15:65215076-65215098 GGAGCTTGGGAACACTGGGAGGG + Intergenic
1128404137 15:67317869-67317891 TGGGGGTGGGAAGAAGGAGATGG - Intronic
1128501441 15:68229785-68229807 GGGGCGGAGGGAGACGGGGCGGG + Intronic
1129351265 15:74957144-74957166 GGGGCGGGGGAGGAGGGGCAAGG - Exonic
1129450891 15:75650623-75650645 GGGCCCTGGGGAGATGGGGATGG + Intronic
1131765880 15:95675408-95675430 GGAGAGTGGGAGGACGGTGAAGG - Intergenic
1132614222 16:832285-832307 GGGGAGGAGCAAGACGGGGAGGG + Intergenic
1132668227 16:1091407-1091429 AGGGGCTGGGAAGAGGGGGAGGG + Intronic
1132828537 16:1916754-1916776 GGGGAGTGGCGAGACGGGGGAGG - Intronic
1132949480 16:2552875-2552897 GGGGTGTGGAAAGACGTGGTTGG + Intronic
1132964868 16:2647291-2647313 GGGGTGTGGAAAGACGTGGTTGG - Intergenic
1133115196 16:3574502-3574524 AGCGCCTGGGAAGGCGGGGACGG + Intronic
1133228875 16:4356976-4356998 GGGGCCCGGGAAGTGGGGGAGGG - Intronic
1133264388 16:4574800-4574822 GGAGTGGGGGAAGACAGGGATGG - Intronic
1133810627 16:9158444-9158466 GGGGCGGGGCAGGACAGGGAAGG - Intergenic
1133995378 16:10744121-10744143 GGGGCGTGGGAGGGAGGGGGCGG + Intronic
1134035749 16:11029875-11029897 GGGGTGTGGGAAGCAAGGGAGGG - Intronic
1134565674 16:15249736-15249758 AAGGCATGGGAATACGGGGAAGG + Intergenic
1134736821 16:16506962-16506984 AAGGCATGGGAATACGGGGAAGG - Intergenic
1134847004 16:17448707-17448729 GGGGAGGAGGAAGAGGGGGAAGG + Intronic
1134930694 16:18205206-18205228 AAGGCATGGGAATACGGGGAAGG + Intergenic
1135296472 16:21283751-21283773 GGAGTGTGGGGAGCCGGGGACGG - Intronic
1135548049 16:23378786-23378808 GGGGCTGGGGAAGACAGGGAAGG + Intronic
1135565750 16:23510083-23510105 GGGGGGTGGGCGGAGGGGGAGGG + Intronic
1135615759 16:23909605-23909627 GGAGGGTGGGAAGAGGGTGAGGG - Intronic
1135668621 16:24356181-24356203 GGGATGGGGGAAGACGGGGCTGG + Intronic
1136145424 16:28313659-28313681 GGAGGCTGGGAAGACAGGGATGG + Intronic
1136468054 16:30458845-30458867 GGCAGGTGGGAAGAAGGGGAAGG + Intergenic
1137446940 16:48537647-48537669 GGGGTGTGGGATGACCTGGAAGG + Intergenic
1137788295 16:51154314-51154336 GGGGGATGGGAGGAGGGGGATGG + Intergenic
1138133375 16:54500943-54500965 GGGGGGTGGGCAGGTGGGGAGGG - Intergenic
1138708518 16:58942415-58942437 GGGGCGGGGGAGGCGGGGGAGGG - Intergenic
1138736767 16:59259891-59259913 GGGGGGTGGGCAGTGGGGGAGGG + Intergenic
1139074664 16:63429387-63429409 GGGGTGGGGGGAGAGGGGGAGGG + Intergenic
1139087271 16:63602540-63602562 GGTGGGTGTGAAGATGGGGATGG + Intergenic
1139949878 16:70663646-70663668 GGGGCCTGAGAGGATGGGGAGGG + Exonic
1140646570 16:77038079-77038101 AGGGGGAGGGAAGAAGGGGAAGG - Intergenic
1141155520 16:81594063-81594085 GGAGCGGGGGAAGAGGGGGAGGG - Intronic
1141325228 16:83050853-83050875 GGTGCATGGGAAGACGAGGATGG - Intronic
1141372175 16:83498178-83498200 GGGGCAAGGGGAGACGGAGATGG + Intronic
1141509686 16:84504475-84504497 GAGGCGTGGGAGGCCAGGGAGGG + Intronic
1141665384 16:85462945-85462967 GGGGGCGGGGGAGACGGGGATGG - Intergenic
1141701560 16:85644644-85644666 GGGGCCTGGGGAGACGGGAGTGG + Intronic
1141804652 16:86334712-86334734 GGGAGGAGGGAAGACGGGGATGG + Intergenic
1142012904 16:87726206-87726228 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012911 16:87726230-87726252 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012926 16:87726279-87726301 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012933 16:87726303-87726325 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012940 16:87726327-87726349 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012947 16:87726351-87726373 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012954 16:87726375-87726397 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012961 16:87726399-87726421 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012968 16:87726423-87726445 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012975 16:87726447-87726469 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012991 16:87726495-87726517 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142012998 16:87726519-87726541 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142013005 16:87726543-87726565 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142013012 16:87726567-87726589 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142013019 16:87726591-87726613 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142013026 16:87726615-87726637 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142013033 16:87726639-87726661 GCGGCGTGGGGAGACGGGCGAGG - Intronic
1142511793 17:400612-400634 GGGGGTTGGGGAGTCGGGGAAGG - Intergenic
1142597823 17:1038146-1038168 GGGGCGTGGGAATTCCGGGGAGG - Intronic
1142766553 17:2067666-2067688 GAGGGGAAGGAAGACGGGGAGGG + Intronic
1143223342 17:5280775-5280797 GGGGGGTGGGGGGAAGGGGAGGG - Intergenic
1143478788 17:7217321-7217343 GGAGCGTGGGAGGGAGGGGAAGG + Intronic
1143582414 17:7834858-7834880 GGGTGGTGGGAAGAAGGCGAAGG - Intergenic
1143615528 17:8047113-8047135 GGGACGTGGGAAGACAGGAAAGG + Intronic
1143617712 17:8063903-8063925 GGGGAGTGGGCAGAGGGAGAAGG - Intergenic
1143651344 17:8265844-8265866 ATGGCCTGGGGAGACGGGGAGGG - Exonic
1144109873 17:12021130-12021152 GCGGGGCGGGAAGCCGGGGAGGG - Intronic
1144899221 17:18568733-18568755 TGGGCGTGGGAAGACTGAAAGGG + Intergenic
1145924053 17:28632888-28632910 AGGGCTTGGGAGGACGGGCATGG - Intronic
1146088913 17:29856685-29856707 GGTAGGTGGGAGGACGGGGATGG - Intronic
1147245203 17:39115671-39115693 GGAGCGTGGGAGGAAGGAGAAGG + Intronic
1147447698 17:40484803-40484825 GGGTCCTGGGAAGCGGGGGAGGG - Intronic
1147612358 17:41809551-41809573 GGGTGGTGGGAATATGGGGAAGG - Intronic
1147819284 17:43232084-43232106 GGCGCGGGGGAAAAGGGGGAAGG + Intergenic
1147819873 17:43235115-43235137 GGCGCGGGGGAAAAGGGGGAAGG + Intergenic
1147821185 17:43242513-43242535 GGCGCGGGGGAAAAGGGGGAAGG + Intergenic
1147821989 17:43247002-43247024 GGCGCGGGGGAAAAAGGGGAAGG + Intergenic
1147824452 17:43261494-43261516 GGCGCGGGGGAAAAAGGGGAAGG + Intergenic
1147825593 17:43267961-43267983 GGCGCGGGGGAAAAGGGGGAAGG + Intergenic
1147826724 17:43274428-43274450 GGCGCGGGGGAAAAGGGGGAAGG + Intergenic
1147827613 17:43279306-43279328 GGCGCGGGGGAAAAGGGGGAAGG + Intergenic
1147828720 17:43285467-43285489 GGCGCGGGGGAAAAGGGGGAAGG + Intergenic
1147830908 17:43297740-43297762 GGCGCGGGGGAAAAGGGGGAAGG + Intergenic
1147831607 17:43301369-43301391 GGCGCGGGGGAAAAGGGGGAAGG + Intergenic
1148348628 17:46922332-46922354 GTGGGGTGGGGAGAGGGGGAAGG + Intergenic
1148575376 17:48706870-48706892 AGGGGGTGGGAAGAGAGGGAGGG - Intergenic
1148721539 17:49757080-49757102 GAGGCCTGGGAAGACTCGGAGGG - Intronic
1148752469 17:49953144-49953166 GGGGAGTGGGAAGAGGGAGGGGG + Intergenic
1148767836 17:50049544-50049566 GGGGCGTGGAAAGATGAGCAGGG + Intergenic
1148850372 17:50551683-50551705 GGGGGCTGGGTAGACCGGGAGGG + Intronic
1149553059 17:57554228-57554250 GGGGCGGGGGAGGGGGGGGATGG + Intronic
1149567829 17:57652280-57652302 GGGGAGGGGGTGGACGGGGAGGG + Intronic
1149585391 17:57782840-57782862 GGGGCGGAGGAGGGCGGGGAAGG + Intergenic
1150181115 17:63121974-63121996 GGGAGGGGGGAAGAGGGGGAGGG + Intronic
1150947685 17:69765600-69765622 AGGGGGAGGGAAGAGGGGGAAGG - Intergenic
1151007125 17:70450439-70450461 GGGGAGTGGGAAGTGGGGGAGGG + Intergenic
1151322704 17:73361285-73361307 GGGGCGTGGGAAGATGGCTCTGG + Intronic
1151453630 17:74213838-74213860 GGGGAGAGGGGAGACGGGAAAGG - Intronic
1151499906 17:74481894-74481916 GGAGGGTGGGCAGAAGGGGAAGG + Intronic
1151677140 17:75604456-75604478 GGGGCGTGGCAGGAAGGGGTGGG - Intergenic
1151822054 17:76501752-76501774 AGGGCGCTGGAAGAAGGGGATGG - Intronic
1151986182 17:77545332-77545354 GGGGCCTGGGAAGGCTGGGATGG + Intergenic
1152054534 17:78013397-78013419 GTGGCGGGGGTAGACAGGGAAGG + Intronic
1152400763 17:80065046-80065068 GGGGAGAGGGAGGAGGGGGAGGG - Intronic
1152471211 17:80490996-80491018 GGGGCGTGGGGTGAAGGGAAGGG - Intergenic
1152625056 17:81384230-81384252 GGGGCGTGGGAAGGCGTTCAAGG + Intergenic
1152644538 17:81462739-81462761 GCGGCGTGGCATGAAGGGGAAGG + Exonic
1152720007 17:81918772-81918794 AGGGGGTGGGAAGAAGGGCAGGG + Exonic
1152789763 17:82272929-82272951 GGGGCGTGGGGAGGCGGGCCTGG - Intronic
1152904536 17:82963032-82963054 GGGGCGCAGGGAGAGGGGGAGGG + Intronic
1152930633 17:83107846-83107868 GGGGCGGGGGGAGACGGGCACGG + Intergenic
1152984685 18:311097-311119 GGGCCCTGGGAAGACTGTGAAGG - Intergenic
1153186337 18:2490510-2490532 GTGGCGTGGGGGGAGGGGGAGGG + Intergenic
1153226420 18:2903420-2903442 GGGGCGTGGGAAGAAGGATGGGG - Intronic
1154007013 18:10539512-10539534 GGGGCTGGGGAATAAGGGGAGGG + Intronic
1154230718 18:12553499-12553521 GAGGCGAGGGAAGAGTGGGAAGG + Intronic
1154932017 18:21009045-21009067 GGGTGGTGGGAGGACGGGGATGG - Intronic
1155328225 18:24687692-24687714 GGAGGGTGGGAAGAGGGAGAGGG - Intergenic
1155730381 18:29150747-29150769 GGGGTGGGGGAAGGGGGGGAGGG - Intergenic
1157152658 18:45233749-45233771 GGGGCGGGGGAAGCGGGGGGTGG - Intronic
1157886888 18:51377297-51377319 GGGTGGAGGGAAGATGGGGATGG + Intergenic
1158345185 18:56508924-56508946 GGGGCTTGGGAATGGGGGGAAGG + Intergenic
1158804827 18:60958206-60958228 GTGGGGTGGGAGGACGGGGGAGG - Intergenic
1158881252 18:61781605-61781627 GGGACTTGGGAAGAGCGGGAGGG + Intergenic
1159623479 18:70667257-70667279 GGGGAGGGGAAAGAAGGGGAGGG - Intergenic
1160058198 18:75506128-75506150 GGGGTGTGGGGAGATGGAGAAGG + Intergenic
1160501001 18:79400961-79400983 GGGGCGTGGGGAGACGGCGGCGG - Intronic
1160676371 19:393528-393550 GGGGTGTGTGATGATGGGGAAGG + Intergenic
1160726759 19:620904-620926 GGGGAGGAGGAAGACGGGCAGGG + Intronic
1160726778 19:620945-620967 GGGGAGGAGGAAGACGGGCAGGG + Intronic
1160794842 19:940562-940584 GGGGCCTGAGAAGAAGGAGAAGG + Intronic
1161066862 19:2242980-2243002 GGGGCTTGGGCAGTCCGGGATGG + Intronic
1161283538 19:3457865-3457887 GGAGCCTGGGAAGAGAGGGAGGG - Intronic
1161439799 19:4284531-4284553 GGGGCGTGGCTAGACGGGGTCGG - Intronic
1161520048 19:4718785-4718807 TGGACCGGGGAAGACGGGGACGG - Intronic
1161735608 19:5990547-5990569 GGGGCGGGGCAATGCGGGGACGG + Intergenic
1161879415 19:6937432-6937454 GGGGGATGGGAGGAGGGGGATGG - Intronic
1162326410 19:10002283-10002305 GGGGTGTGGGAAGAGGGTGGTGG + Intronic
1162471025 19:10871979-10872001 GGGGCGGGGGCCGGCGGGGAGGG + Intronic
1162535747 19:11262228-11262250 GGAGCGGGAGAAGGCGGGGAGGG - Intronic
1162784164 19:13023824-13023846 GGGGGGGGGGAGGAGGGGGAAGG + Intronic
1162932075 19:13962368-13962390 GGGTGGTGGGAGGACGGGGCTGG + Exonic
1162968245 19:14165767-14165789 GGGAGAGGGGAAGACGGGGAGGG + Intronic
1163085791 19:14979251-14979273 GGGAGGTGGGGAGACGGGCAGGG + Intronic
1163197527 19:15733471-15733493 GGGGCTTGAGGAGAGGGGGAAGG + Intergenic
1163282173 19:16324832-16324854 GGGGCGCGGGCGGGCGGGGACGG - Exonic
1163435620 19:17293460-17293482 GGGGCGGGGGTGGGCGGGGAAGG + Intronic
1163463392 19:17452696-17452718 GGGGAGTGGGGAGGTGGGGATGG + Intronic
1163566552 19:18055222-18055244 GGGAGGTGGGAAGAGGGGCAGGG + Intergenic
1163581047 19:18138937-18138959 GCGGTGTGGCAATACGGGGAGGG - Intronic
1163610109 19:18296249-18296271 GGGGCCTGGGGATATGGGGAAGG - Intergenic
1163611560 19:18304472-18304494 GGGGAGTGAGAGGAGGGGGATGG + Intergenic
1163623530 19:18374657-18374679 GGCGGGGGGGAAGAGGGGGAGGG + Intergenic
1163738943 19:18998981-18999003 GGGCCCTGGGATGACGGGTAGGG + Intronic
1164360345 19:27501113-27501135 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
1164648256 19:29874220-29874242 GGGGCGAGGGGGGAGGGGGAGGG + Intergenic
1165782197 19:38441258-38441280 GGGGCGTGGGGAGGGGGGGTAGG + Intronic
1165793512 19:38506004-38506026 GGGGCATGGCCAGACAGGGAAGG + Intronic
1165863239 19:38920056-38920078 GGGGCGTGGGGAGCCAGGGGAGG + Intronic
1165899890 19:39164413-39164435 CGGGCCTGGGAAGTCAGGGAAGG + Intronic
1165936030 19:39389618-39389640 GGTGTGTGGGGAGACAGGGAGGG - Exonic
1166015120 19:39973929-39973951 GGTTTGTGGGAAGACAGGGAGGG + Intronic
1166117805 19:40666794-40666816 GGGGTCCGGGAAGAAGGGGAAGG - Exonic
1166474174 19:43106609-43106631 GTGGGGTGGGAAGATGGGGGAGG + Intronic
1166727874 19:45039606-45039628 AGGGAGTGGGAACACGGGGAGGG - Intronic
1166830828 19:45638823-45638845 GGTGAGTGGGGAGATGGGGAAGG - Exonic
1167075006 19:47243253-47243275 GGGGGCTGGGAGGGCGGGGAGGG + Intergenic
1167108776 19:47447003-47447025 GGGGCCTGGGAAGGCAGGGCAGG - Intronic
1167117298 19:47495744-47495766 AGGGGCTGGGAAGAAGGGGACGG + Intronic
1167428780 19:49442813-49442835 GGGCCGGGGCAAGACTGGGAGGG - Intergenic
1167724627 19:51201636-51201658 GGGGAGTGGGTAGCGGGGGATGG + Intergenic
1168282378 19:55312402-55312424 GGGGCCCGGGAAGAGGGGGTTGG - Exonic
1168340734 19:55621774-55621796 GGGGCGGGGGGAGACCGCGAAGG - Exonic
1168389359 19:55993479-55993501 GGGGAGGGGGGAGAGGGGGAGGG - Intergenic
925048789 2:795522-795544 TGGACCAGGGAAGACGGGGACGG + Intergenic
925587197 2:5475559-5475581 GGGGCCTGGGAAGAGGGAGAGGG + Intergenic
925781735 2:7387865-7387887 TGGGGGTGGGAAGATGGGGGAGG + Intergenic
926089782 2:10042772-10042794 GGGGCCTGGGAAGAATGGGCGGG + Intergenic
926369174 2:12163119-12163141 GGGGAGAGGGAAGAAGGGGGAGG + Intergenic
926431386 2:12789602-12789624 GGGGAGGGGGGAGGCGGGGAGGG - Intergenic
926801820 2:16665882-16665904 GGGGCGGGGAGGGACGGGGAGGG - Intronic
927387180 2:22548196-22548218 GGGGGGTGGGGGGAGGGGGAGGG + Intergenic
927658540 2:24972067-24972089 GGAGCGTGGGGAGCCGGGGGAGG + Exonic
927858253 2:26540738-26540760 GGGGCGGGGGCAGGTGGGGAAGG + Intronic
928241625 2:29591709-29591731 GGGGCCTGGTAAGACAAGGAAGG + Intronic
928301339 2:30127958-30127980 GGGGTATGGGAAGAGGGTGAAGG - Intergenic
928602450 2:32916218-32916240 GGGGCGTGGGTAGGGGGGGGGGG + Intergenic
929232621 2:39575159-39575181 GGGGTGGGGGGAGAGGGGGAGGG - Intergenic
929538567 2:42801400-42801422 GGAGGGAGGGAAGACAGGGAGGG - Intergenic
929562207 2:42963008-42963030 GGGAGGAGGGAAGAGGGGGATGG - Intergenic
929675293 2:43920764-43920786 GGACTGTGGGAAGACAGGGAAGG + Intronic
929713517 2:44288394-44288416 GGGGTGGGGGAAGAAAGGGAGGG - Intronic
929892464 2:45929706-45929728 GGGTGGGGGGAAGATGGGGATGG - Intronic
929998533 2:46845634-46845656 GTGTCCTGGGAAGACGGGTAAGG - Intronic
930222156 2:48755794-48755816 GGTGCGCGGTAAGAGGGGGAGGG - Intronic
930366545 2:50446500-50446522 GGGAGGGAGGAAGACGGGGAAGG - Intronic
930788239 2:55294640-55294662 GAGGGGTGGGAAGAGGAGGAAGG + Intronic
930852509 2:55975618-55975640 GGGGGGTGGGAAGAGGAGGGTGG + Intergenic
931355885 2:61537606-61537628 AGGGCGAGGGAAGGTGGGGAGGG + Exonic
931431213 2:62210390-62210412 GGGGAGTAGGAAGACCAGGAAGG + Intronic
931474175 2:62570997-62571019 TGGGCGTGGCAAGATGGAGAAGG + Intergenic
931693070 2:64851791-64851813 GGGGGGTGGGAGGGAGGGGAGGG - Intergenic
932015405 2:68021866-68021888 GGGGGGTGGGAAGAAGTGGGCGG - Intergenic
932117750 2:69068531-69068553 GGGGCTTGGGAAGACCAGTATGG + Intronic
932380328 2:71276495-71276517 GGAGCGCGGGAAGCCGGGGGCGG - Intergenic
933303867 2:80573512-80573534 GGAGCAAGGGAAGATGGGGAAGG - Intronic
933435571 2:82244976-82244998 GTGGGGTGGGAAGAGGGGGAAGG + Intergenic
933629944 2:84644577-84644599 GGGGAGTGGGAGGAGGGAGAGGG - Intronic
933891002 2:86769819-86769841 GGGCCTGGGGAAGAAGGGGAGGG + Intronic
933935775 2:87202726-87202748 TGGGAGGGGGAAGGCGGGGATGG + Intergenic
934663789 2:96156814-96156836 AGGGGGTGGGCAGACGGGGCCGG - Intergenic
934712626 2:96526021-96526043 GGGGAGTCTGAAGAGGGGGAAGG - Intergenic
934746113 2:96760837-96760859 GGGGCGTGGGCAGGCGGGGCGGG + Intergenic
935143370 2:100376146-100376168 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
935361648 2:102250852-102250874 GGGGCGTGGGGGGATAGGGAGGG + Intergenic
935580973 2:104755622-104755644 GAGGCTTGGGAAGACGCGAACGG - Intergenic
935787649 2:106563448-106563470 GGGGTCTGGGAGGATGGGGAAGG + Intergenic
935806483 2:106753804-106753826 GGGGCTTGGGAGCATGGGGAGGG - Intergenic
935971496 2:108534399-108534421 GGGGCGCGGGAGGGGGGGGAAGG - Intronic
936012916 2:108936508-108936530 AGAGCGTGGGAGGCCGGGGAAGG - Intronic
936357373 2:111763104-111763126 TGGGAGGGGGAAGGCGGGGATGG - Intergenic
936524885 2:113235614-113235636 GGGGTGTGAGATGGCGGGGAGGG + Intronic
936674860 2:114702998-114703020 GCAGGGTGGGAAGAAGGGGAGGG + Intronic
937068727 2:119044582-119044604 GGGACTTGGGAAGAGTGGGAGGG - Intergenic
937577167 2:123437729-123437751 GGGGGGTAGAAAGAAGGGGAAGG + Intergenic
937953767 2:127408049-127408071 GGGGAGGGGGGAGACGAGGAGGG - Intergenic
938019376 2:127893576-127893598 GGGTGGTGGGAAGATGGGCAGGG - Intergenic
938829300 2:135034813-135034835 GGGCTGTGGGGAGAGGGGGAGGG + Intronic
939604307 2:144234835-144234857 GGGGAGTGAGAACATGGGGAAGG + Intronic
940830250 2:158457715-158457737 GGGGCGTGGGAAGACGGGGAGGG - Intronic
941690543 2:168497102-168497124 GGGGCGTGGGTAGCCTGGAAAGG + Intronic
941768536 2:169326168-169326190 GGGGAGAGGGGAGAGGGGGAGGG - Intronic
941809262 2:169739071-169739093 GGGGTGGGGGAAGTCGAGGAGGG - Intronic
941973208 2:171374652-171374674 GGTGAGTGGGGAGAAGGGGAGGG - Intronic
942411607 2:175715115-175715137 GGGGTTTGGGGAGAAGGGGAGGG + Intergenic
942447124 2:176085518-176085540 GAGGCGAGGGAGGACGGGGATGG + Intergenic
942602674 2:177657621-177657643 GGGGAGTGGGGAGAGGGGCAGGG + Intronic
942790152 2:179752076-179752098 GTGGGGTGGGGAGAGGGGGAGGG - Intronic
942906103 2:181182553-181182575 GTGGGGTGGGAGGAGGGGGAAGG + Intergenic
942935908 2:181556383-181556405 GGGGTGGGGGAAGGTGGGGAGGG - Intronic
942940085 2:181606347-181606369 GGGGAGGGAGAAGAGGGGGAGGG + Intronic
943277214 2:185882830-185882852 GTGGGGTGGGAGGAGGGGGAGGG - Intergenic
943361386 2:186923189-186923211 GGGGTGGGGGGAGAGGGGGAGGG + Intergenic
944544694 2:200787747-200787769 GCGGCGTAGGAAGAAGGTGAAGG - Intergenic
944815757 2:203373477-203373499 GGGCCGTGGGGAGAGGGAGAGGG + Intronic
945604419 2:211910580-211910602 GGAGGGTGGGAAGATGGAGAGGG + Intronic
946160240 2:217831425-217831447 GGGAAGAGGGAAGATGGGGAGGG - Intronic
946400269 2:219464967-219464989 GGGGCGAGAGGAGAGGGGGAGGG - Intronic
946967418 2:225052152-225052174 GGGGGGTGGGGAGATGGGGGAGG + Intergenic
947232677 2:227903654-227903676 GGAGGGTGGGAGGAAGGGGAGGG - Intronic
947232685 2:227903671-227903693 GGAGGGTGGGAGGAAGGGGAGGG - Intronic
947298875 2:228665826-228665848 GGGGTGTTGGGAGAAGGGGAGGG + Intergenic
947411270 2:229843100-229843122 GGGGGGTGGGGAGAGAGGGAGGG - Intronic
947418386 2:229921428-229921450 GGGGGGTGTGAAGACGGCAAGGG - Intronic
947434153 2:230058483-230058505 GGGGTGAGGGAAGATGGGAATGG + Intronic
947744862 2:232502259-232502281 GAGGGGTGGGAGGAGGGGGAGGG + Intergenic
948294059 2:236847884-236847906 GGGGTGTAGGAGGAGGGGGAGGG + Intergenic
948294135 2:236848125-236848147 GGGGTGTAGGAGGAGGGGGAGGG + Intergenic
948811282 2:240479676-240479698 GGGGAGGGGGAAGAGGGGGCTGG + Intronic
1168849220 20:965249-965271 TGGGGGTGGGATGGCGGGGAAGG + Intronic
1168893589 20:1309216-1309238 GGGAAGTGGGGAGGCGGGGAGGG + Exonic
1169072045 20:2738689-2738711 GGGGCCTGAGGAGAAGGGGAGGG - Intronic
1169266921 20:4172521-4172543 GGGGCGAGGGAGGAGAGGGACGG + Intronic
1169329716 20:4706682-4706704 GGGCCCTGGGAAGAAGGTGAGGG - Intergenic
1170549392 20:17463649-17463671 GGGGGGTGGGGGGATGGGGAGGG - Intronic
1170579492 20:17687110-17687132 GGGGCGGGGAAATACAGGGAAGG + Intergenic
1170700005 20:18695430-18695452 GGGGAAGGGGAAGAAGGGGAAGG - Intronic
1170806588 20:19638061-19638083 GGGGTGGGGGATGAGGGGGAAGG - Intronic
1170809187 20:19660274-19660296 GGGGGGTGGGAGGAGGGGCAAGG - Intronic
1170845621 20:19959558-19959580 GGGGGGTGGGAAGATGGGTATGG - Intronic
1171455738 20:25271158-25271180 AGGGCGTGGGAGGATGGGGGGGG - Intronic
1171484337 20:25476586-25476608 GGGCCGTGGGATGCCGGGGCAGG + Exonic
1172081018 20:32340689-32340711 GGGGTTTGGGGACACGGGGATGG + Intergenic
1172196500 20:33095324-33095346 GGGGCGGGGGAAGACACAGAGGG + Intronic
1172647402 20:36479540-36479562 GGGGCCTGGGAAGACTGTTAGGG + Intronic
1172801405 20:37578930-37578952 GGGGCCAGTGAAGCCGGGGAAGG + Intergenic
1172852594 20:37977330-37977352 GGGGGGGGGGGAGACGGGGGCGG + Intergenic
1173620279 20:44431011-44431033 GGGGCGGGTGAGGGCGGGGAGGG - Exonic
1174267293 20:49341096-49341118 GGGGAGAGGGAAGTGGGGGAGGG - Intergenic
1174267310 20:49341133-49341155 GGGGAGAGGGAAGGGGGGGAAGG - Intergenic
1175120114 20:56710680-56710702 GGGGAGTGGGAAGAGGAAGAGGG - Intergenic
1175847483 20:62066137-62066159 GGGGCGGTGGCGGACGGGGAGGG + Intergenic
1175863174 20:62160966-62160988 GGGGTGGGGGTAGTCGGGGAAGG + Intronic
1175890371 20:62313290-62313312 GGGGTGGGTGGAGACGGGGAGGG + Intronic
1175923004 20:62458794-62458816 GGGGAGGAGGAAGACGGGGTGGG - Intergenic
1175950970 20:62582820-62582842 GGGGCTTGGGAAGCCAGAGATGG + Intergenic
1176072411 20:63234137-63234159 GGGGCGGTGGAGGACAGGGAGGG + Intergenic
1176199112 20:63852301-63852323 GGGGAGTGGGGAGATGGGTAGGG - Intergenic
1176668317 21:9707985-9708007 GGGAGGTGGGAAGAGGGAGAGGG + Intergenic
1176737749 21:10567190-10567212 TGGGGGTGGGGAGATGGGGATGG + Intronic
1178283665 21:31306828-31306850 GGGGCGCTGGAAAACGGCGAAGG - Intronic
1178738446 21:35174235-35174257 GTGGGGTGGGGAGAGGGGGAAGG - Intronic
1179496730 21:41776568-41776590 GGGGCACTGGAAGCCGGGGAGGG + Intergenic
1179633534 21:42693034-42693056 GGGCCGTGGGAAGGCTGGGCAGG + Intronic
1179802834 21:43819512-43819534 GGGGGGTGGGGAGAAGGGGAGGG + Intergenic
1179997433 21:44980472-44980494 GGGGCCTGAGAAGAAGGGGAGGG - Intergenic
1180095476 21:45554019-45554041 GGGGCGCGGGGAGATTGGGATGG - Intergenic
1180095601 21:45554282-45554304 GGGGCGCGGGGAGATTGGGAGGG - Intergenic
1180146996 21:45927303-45927325 GGGGAGAGGGAGGAAGGGGAGGG - Intronic
1180840714 22:18957662-18957684 GGGGCTTGGGAAGGTGGGGATGG + Intergenic
1181060773 22:20281112-20281134 GGGGCTTGGGAAGGTGGGGACGG - Intronic
1181167376 22:20991017-20991039 GGTGCGTGGGAGGAAGGGCAGGG + Intronic
1181791011 22:25266561-25266583 GGAGCATGGTGAGACGGGGAGGG - Intergenic
1181792519 22:25278683-25278705 GGGGGAGGGGAAGAGGGGGAGGG + Intergenic
1181826823 22:25523591-25523613 GGAGCATGGTGAGACGGGGAGGG - Intergenic
1181883385 22:25999546-25999568 GAGGAGGGGGAAGAGGGGGAGGG - Intronic
1181967643 22:26668095-26668117 GGGATGTGGGAAGTTGGGGATGG + Intergenic
1182236900 22:28883480-28883502 GGGGAGTGAGAAGGCGGGGCAGG - Intergenic
1182320873 22:29478134-29478156 GGGAGGAGGGAAGAGGGGGAGGG - Intergenic
1182746138 22:32607000-32607022 GGGGTGGGGGGAGGCGGGGAGGG - Intronic
1182972144 22:34589035-34589057 GGGAGGGGGGAAGAGGGGGAGGG + Intergenic
1183004850 22:34892542-34892564 GGGGCATGGGAAGAGGCTGAAGG + Intergenic
1183296114 22:37030475-37030497 GAGGGCTGGAAAGACGGGGAGGG - Intergenic
1183311071 22:37109758-37109780 GGGGTGGGGGAAGATGGGGCGGG - Intergenic
1183317130 22:37142917-37142939 GGGGTGGGGGAAAATGGGGAGGG - Intronic
1183423535 22:37725666-37725688 GGGCTCTGGGAAGAAGGGGAAGG - Exonic
1183569333 22:38640487-38640509 GGGGCGTAGGAGGATGGGGGTGG - Intronic
1184147243 22:42618971-42618993 GGGGTGAGGGAAGGAGGGGACGG + Exonic
1185345190 22:50307777-50307799 GGGGAGGGGGGAGAGGGGGAGGG + Intergenic
1185345199 22:50307792-50307814 GGGGAGGGGGGAGAGGGGGAGGG + Intergenic
1185345207 22:50307807-50307829 GGGGAGGGGGAAGAGGGGGAGGG + Intergenic
1185345223 22:50307836-50307858 GGGGAGGGGGAAGAGGGGGAGGG + Intergenic
950043204 3:9933376-9933398 GGGCAGTGTGAAGACGGGCACGG - Exonic
950429051 3:12940530-12940552 GGAGTCTGGGAAGACGGGAAAGG + Intronic
950531748 3:13556316-13556338 GGGGGGTGGGAAGCGGCGGACGG + Intronic
950976966 3:17256889-17256911 GAGGCATGGGAAGATGGGGGTGG + Intronic
951198760 3:19854481-19854503 GGGGTTTGGGAAGGGGGGGAGGG + Intergenic
951485407 3:23203672-23203694 GGGGGATGGGAAGAAGGGGGAGG - Intronic
952089127 3:29863218-29863240 GGGGTGGGGGGAGAGGGGGAGGG + Intronic
952114355 3:30161377-30161399 GAGGAGGGGGAAGAAGGGGAGGG - Intergenic
952728194 3:36611583-36611605 GTGGGGTGGGGAGAGGGGGAAGG + Intergenic
952895441 3:38075612-38075634 GGGGCGTGGAAATAAGGGGTTGG + Intronic
953564636 3:44021396-44021418 GGGGGGAAGGAAGAGGGGGAAGG - Intergenic
953688211 3:45094711-45094733 GGGGTGTGGGGGGATGGGGATGG + Intronic
953752255 3:45617792-45617814 GGGGAGCGGGAGGACGGGAAGGG + Intronic
953831038 3:46297703-46297725 GGGCCGTGGGAGGAAGGGAAGGG - Intergenic
953854648 3:46491949-46491971 GGGAGGAGGGAGGACGGGGATGG - Intergenic
953864840 3:46575394-46575416 GGGGGGTGGGGAGAAGGGGAAGG - Intronic
953924727 3:46976880-46976902 GGGGCGGGGCAAGGCGGGGAGGG - Intronic
954631269 3:52048873-52048895 GGGGCCTGGGAAGGAGGGGAAGG - Intergenic
955036178 3:55270233-55270255 GGGGGGCGGGAAGACAGGGGAGG - Intergenic
956219335 3:66884815-66884837 GGGGAGAGGGAAGGAGGGGAAGG + Intergenic
956290357 3:67654436-67654458 GGGGCGAGGGAAGCCCGGGCAGG + Intronic
956497112 3:69839878-69839900 GGGGTGTGGGGGGAGGGGGATGG - Intronic
957731803 3:84148535-84148557 GGGTAGTGGGAAGATGGGGATGG - Intergenic
958164223 3:89858469-89858491 AGGGGGTGGGAGGAAGGGGAGGG + Intergenic
958431160 3:94043535-94043557 GGGGAGGGGGAGGAGGGGGAGGG - Intronic
958496647 3:94851875-94851897 GTGGGGTGGGGAGAGGGGGAGGG + Intergenic
958615057 3:96482732-96482754 GGGGGGTGGGGAAAAGGGGAAGG - Intergenic
958651823 3:96946314-96946336 GGGGTGGGGGAAGGGGGGGAGGG - Intronic
959032232 3:101312917-101312939 TAGGCCTGGGAAGAGGGGGAAGG + Intronic
959104026 3:102045895-102045917 GTGGTGTGGGAGGAGGGGGAAGG + Intergenic
959963736 3:112331741-112331763 GGGGCGGTGGGAGACGGGGGCGG - Intergenic
960050689 3:113236520-113236542 GGAGGGTGGGAAGAGGGTGAGGG + Intronic
960123402 3:113970709-113970731 GTGGGGTGGGGGGACGGGGAGGG - Intronic
960912777 3:122665952-122665974 GGGGCCTGGGAACATGGGGAAGG + Intergenic
961324146 3:126100204-126100226 GGTACGTGGCAAGAGGGGGAGGG - Intronic
961345354 3:126260357-126260379 GGGGAGAAGGAAGAGGGGGAGGG - Intergenic
961422412 3:126816854-126816876 GTGGGGTGGGAAGAGGGGGGAGG - Intronic
961530431 3:127537031-127537053 GGGAGGTGGGAAGTGGGGGAGGG + Intergenic
961612596 3:128152942-128152964 GGGGGGCGGGAAGACGGGGGCGG - Intronic
961612609 3:128152965-128152987 GGGCGGGGGGAAGACGGGGGCGG - Intronic
961940923 3:130636869-130636891 GGGGAGGGGGAGGAAGGGGAAGG - Intronic
961988876 3:131166626-131166648 GAGGGGTGGGAAAAGGGGGATGG - Intronic
962175918 3:133154710-133154732 GTGGGGTGGGGGGACGGGGAAGG + Intronic
962838361 3:139210195-139210217 GTGGGGTGGGGAGACGGGGGAGG - Intronic
963666798 3:148198420-148198442 GTGGGGTGGGGAGAGGGGGAAGG - Intergenic
963755082 3:149226644-149226666 GGGGGGTGGGGTGATGGGGAGGG - Intergenic
963924295 3:150935286-150935308 GTGGGGTGGGAAGAGGGGGGAGG - Intronic
964801847 3:160565748-160565770 GCGGCGGGGGCAGGCGGGGAAGG + Intergenic
965444399 3:168757265-168757287 GGGGGGTGGGGGGATGGGGAGGG - Intergenic
965801726 3:172500857-172500879 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
966027402 3:175301266-175301288 GGGGTTTGGGAACAAGGGGAGGG - Intronic
966110452 3:176394881-176394903 GTGGGGTGGGGAGACGGGGGAGG - Intergenic
966206853 3:177413686-177413708 AGACCGTGGGAAGAGGGGGAGGG + Intergenic
966499137 3:180618549-180618571 GTGGGGTGGGGAGAGGGGGAAGG - Intronic
967272273 3:187741495-187741517 GGGGAGTGGGGAGTCGGGTATGG + Intronic
967508810 3:190286547-190286569 GGGGTGGGGGAAGGGGGGGAGGG - Intergenic
967858632 3:194135675-194135697 GGGGCGGGGGGAGGGGGGGACGG - Intergenic
967940632 3:194763551-194763573 GGGGCCTGTGAAGACGCTGATGG - Intergenic
968516586 4:1018104-1018126 AGGGCCTGTGAAGACGGGGAAGG + Intronic
968663374 4:1807995-1808017 GGGGCGTGGGGGGGCGTGGAGGG + Exonic
968850376 4:3074232-3074254 GGGGCGGGGCGAGACGGGGGCGG - Intergenic
968890029 4:3363887-3363909 TGGGCGGGGGAAGCTGGGGAAGG + Intronic
969202357 4:5616186-5616208 GGGGAGAGGGAAGGTGGGGAGGG - Intronic
969365884 4:6694102-6694124 GGGGCTGGGGAAGAAGGGGAAGG + Intronic
969453610 4:7288560-7288582 GGGGCGGGGGGAGAGGGGGTGGG + Intronic
969483300 4:7458200-7458222 GGGGCGGGGGGAGGCGGGGCTGG + Intronic
970456206 4:16226517-16226539 GGGGCGGGGCGAGGCGGGGAGGG - Exonic
970979402 4:22079053-22079075 GTGGGGTGGGGAGAAGGGGAGGG - Intergenic
971450833 4:26800147-26800169 GTGGGGTGGGGAGACGGGGAGGG - Intergenic
972311991 4:37890795-37890817 GGGGGGTGGCAAGGAGGGGAGGG + Intergenic
972686895 4:41360719-41360741 GGGGCGGGGAGAGGCGGGGAGGG + Intronic
973722622 4:53740638-53740660 GGGGTGGGGGAAAGCGGGGAGGG + Intronic
973752617 4:54037267-54037289 GGAGCCTGGGAAGTCTGGGAAGG + Intronic
973774197 4:54230432-54230454 GGGGCGCGGGAAGACAGGCGGGG - Intronic
974132286 4:57771578-57771600 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
974770302 4:66403338-66403360 GTGGGGTGGGGAGAGGGGGAAGG + Intergenic
975762082 4:77630577-77630599 GGGGTGTGGGTAGATGGGGCGGG + Intergenic
975886732 4:78975455-78975477 GGGGTGGGGGGAGAGGGGGAGGG - Intergenic
976729200 4:88245123-88245145 GGGGCGGGGGAAGGTGGGGAGGG - Intergenic
977559013 4:98513545-98513567 TGGGGGTGGGAGGAAGGGGAAGG + Intronic
977644211 4:99393762-99393784 GGGGTGTGGGGACAAGGGGAAGG - Intergenic
977788363 4:101067665-101067687 GTGGGGTGGGGGGACGGGGAGGG + Intronic
977823858 4:101507053-101507075 GTGGGGTGGGGAGAGGGGGAAGG - Intronic
978323837 4:107527907-107527929 GTGGGGTGGGGGGACGGGGAGGG + Intergenic
978547302 4:109885032-109885054 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
978626789 4:110694230-110694252 GGGGGGTGGGAGGATGGGGTTGG - Intergenic
978911131 4:114065451-114065473 GGAGGGTGGGAGGAAGGGGAGGG - Intergenic
978935011 4:114364025-114364047 GTGGGGTGGGGGGACGGGGAAGG - Intergenic
979367254 4:119840315-119840337 GGGGGGTGGGAGGGCGGGGATGG - Intergenic
979919839 4:126481813-126481835 GGGGTGAGGGAAGTGGGGGAGGG + Intergenic
979995921 4:127430808-127430830 GGGACTTGGGAAGAGTGGGAGGG + Intergenic
979996058 4:127432355-127432377 GTGGGGTGGGGAGACGGGGGAGG + Intergenic
980890571 4:138810394-138810416 AGGGCGGGGGGAGGCGGGGAGGG + Intergenic
981079160 4:140622156-140622178 GGGGAGTGGGAGGAGAGGGAGGG - Exonic
981205609 4:142036044-142036066 GGGGAGAGGGAAGGAGGGGAGGG - Intronic
981460718 4:145010674-145010696 GGGGTGGGGAAAGAGGGGGAGGG + Intronic
981800563 4:148650532-148650554 GGGGACTGGGAAGACAGGGAAGG + Intergenic
982094593 4:151910624-151910646 TGGGGGTGGGAAAACAGGGAAGG - Intergenic
983570999 4:169207969-169207991 GGGTCCTGGGATGAGGGGGATGG + Intronic
984758171 4:183342886-183342908 GGGGCGGGGGAAGAGGGTGGTGG - Intergenic
984935316 4:184884395-184884417 GGAGGGTGGGGAGGCGGGGATGG + Intergenic
985223386 4:187732036-187732058 GGGGAGGAGGAGGACGGGGAGGG - Intergenic
985348713 4:189035280-189035302 TGGGCGTGTGGAGACGGGCAGGG - Intergenic
985406465 4:189643510-189643532 GGGAGGTGGGAAGAGGGAGAGGG - Intergenic
985652186 5:1112333-1112355 GGGGCCGGGGAGGGCGGGGAGGG - Intergenic
985660567 5:1155085-1155107 GGGGCCTGGGAGGGCGGGGCGGG - Intergenic
985788577 5:1913024-1913046 TGGGCGTGGGAAGGCCGTGAAGG + Intergenic
986305978 5:6517237-6517259 GAGGCGTGGGAAGGTGGGCAAGG + Intergenic
986693609 5:10333438-10333460 GGGGTGTGGGGCGCCGGGGAAGG + Intergenic
986946640 5:13029226-13029248 GGGGAAGGGGAAGAAGGGGAAGG + Intergenic
986946646 5:13029241-13029263 GGGGAAGGGGAAGAAGGGGAAGG + Intergenic
986946652 5:13029256-13029278 GGGGAAGGGGAAGAAGGGGAAGG + Intergenic
986946689 5:13029356-13029378 GGGGAAGGGGAAGAAGGGGAAGG + Intergenic
986946695 5:13029371-13029393 GGGGAAGGGGAAGAAGGGGAAGG + Intergenic
987447582 5:18039883-18039905 GTAGAGTGGGAAGGCGGGGAGGG - Intergenic
988123519 5:26998579-26998601 GTGGGGTGGGGAGACGGGGGAGG + Intronic
989592038 5:43121157-43121179 GGGGCGGGGCAGGACGGGGCGGG + Intronic
990778099 5:59326116-59326138 GTGGGGTGGGAGGAGGGGGAAGG + Intronic
992265693 5:75016156-75016178 GGTGGGTGGGAAGAGGGAGAGGG + Intergenic
992910712 5:81393895-81393917 GGGGGGTAGGAAGGCGAGGAAGG - Intronic
993646997 5:90474423-90474445 GGGGCGTGGGATGCGGGGGTCGG + Exonic
993651681 5:90529661-90529683 GGGGCGGGGGAGGACGCGGAGGG + Intronic
994185068 5:96807675-96807697 GGGGCGCGGGAGGAAGGCGACGG - Intronic
994185075 5:96807696-96807718 GGGGCGCGGGAGGAAGGCGACGG - Intronic
994956105 5:106535163-106535185 GGAGGGTGGGAAGAGGGAGAGGG - Intergenic
995618365 5:113993894-113993916 GGGGGTTGGGAGGAAGGGGAGGG - Intergenic
996733523 5:126738232-126738254 GGAGGGTTGGAAGACTGGGAGGG - Intergenic
996733548 5:126738379-126738401 GGAGGGTTGGAAGACTGGGAGGG - Intergenic
996733574 5:126738526-126738548 GGAGAGTTGGAAGACTGGGAGGG - Intergenic
997321820 5:132983947-132983969 GGGGGGGGGGGAGAGGGGGAGGG + Intergenic
997832255 5:137160112-137160134 GGGACTTGGGAAGAGTGGGAAGG - Intronic
998497821 5:142605931-142605953 GGGCCTTGGGAAGAGAGGGAGGG + Intronic
999251159 5:150183236-150183258 GTGGCCTGGGAAGATGGAGAGGG + Intronic
1000730205 5:164825703-164825725 GGAGGGTGGGAGGACGGTGAGGG + Intergenic
1001011479 5:168103021-168103043 GGGGTGGGGGGAGGCGGGGAGGG - Intronic
1001035372 5:168292672-168292694 GGGGGGTGGGCGGATGGGGATGG + Intronic
1001359338 5:171065299-171065321 GGGGGGTGGGGTGAAGGGGACGG + Intronic
1002079538 5:176729125-176729147 GGGGTGCGGGAGGCCGGGGAAGG - Intergenic
1002176418 5:177403735-177403757 GGGGCGTGGAAAGAAGGGTGGGG + Intronic
1002443441 5:179275900-179275922 GGGGCATGAGAAGAAGGGCAAGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002569379 5:180131359-180131381 GGGGAGTGGGGACATGGGGAGGG - Intronic
1002841829 6:913101-913123 GGGGGGTGGGGAGCGGGGGAAGG - Intergenic
1003060635 6:2859922-2859944 GGGGCTGGGGAACACGGGAATGG + Intergenic
1003093521 6:3124043-3124065 GGGGTGTGGGAAGAAGGTAAAGG + Intronic
1003818467 6:9867943-9867965 GGGGTGTGGGGACAAGGGGAGGG - Intronic
1003873751 6:10420002-10420024 GGCGGGTGGGGAGGCGGGGACGG - Intergenic
1004005240 6:11632125-11632147 GGGGGGTGGGAAGAGAGAGAAGG - Intergenic
1004508171 6:16263567-16263589 GGGGCGTGGAAATAAGGGGTTGG + Intronic
1005463044 6:26087372-26087394 GGGGGGCGGGGAAACGGGGATGG - Exonic
1006070962 6:31497812-31497834 TGGGGGTGGGAATGCGGGGATGG + Intronic
1006300880 6:33192963-33192985 GGGGCGGGGGATGTGGGGGAAGG + Intergenic
1006427531 6:33975783-33975805 GGGGCGTGGGGAGGGGGGAATGG - Intergenic
1006750281 6:36372693-36372715 GGGGCTGGGGAAGACTGGAAAGG + Intronic
1006787637 6:36679101-36679123 GGGGCGAGGGAGGGCGTGGACGG + Intronic
1006806352 6:36792173-36792195 GGGGCGGGGGAGGATGGGCAGGG - Intronic
1006814153 6:36839517-36839539 GGGGCGTGGGAAGTGAGAGAGGG + Exonic
1006847003 6:37069287-37069309 GCAGGGTGGGAAGCCGGGGAGGG - Intergenic
1006944730 6:37777782-37777804 GGGACGGGGGAAGACTGGGAGGG + Intergenic
1007099077 6:39232125-39232147 GGGGAGTGGGGAGATGGGGAGGG - Intergenic
1007597884 6:43062821-43062843 GGGACGTGGCAAGACTGGCAGGG - Intronic
1007759022 6:44121357-44121379 GGGGGGTGGGAAGAGAGGGTGGG + Intronic
1007761076 6:44134173-44134195 TGAGCCTGGGAAGACAGGGAGGG - Intronic
1007947810 6:45841476-45841498 GGGGTGGGGGAAGAAGGGGTGGG + Intergenic
1007987820 6:46224922-46224944 GGGGTGGGGGAAGGGGGGGAGGG - Intronic
1011113072 6:83859795-83859817 GGGGCCGGGAAAGACTGGGAAGG - Exonic
1011237098 6:85229754-85229776 GGAGCCTGGGAAGGAGGGGAAGG - Intergenic
1011764536 6:90605812-90605834 GGGGGGGGGGAGGAGGGGGAAGG + Intergenic
1011803684 6:91047290-91047312 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
1012061577 6:94490703-94490725 GTGGGGTGGGGAGAGGGGGAGGG + Intergenic
1012207297 6:96477600-96477622 GGGGTGGGGGAAGAGAGGGAGGG - Intergenic
1012701420 6:102461473-102461495 GGGGCTGGGGAACAAGGGGAGGG + Intergenic
1012983876 6:105854902-105854924 GGGCCGTGGGGAGAGGGGGAGGG + Intergenic
1013036058 6:106384321-106384343 AGACCGGGGGAAGACGGGGACGG + Intergenic
1013367446 6:109446645-109446667 GGGGCATGGGAAGAGGAAGAGGG - Intronic
1013473421 6:110486349-110486371 GGGAGGTGGGAAGAAAGGGAGGG + Intergenic
1013535213 6:111057585-111057607 GGGTGGTTGGAAGACAGGGATGG + Intergenic
1014121230 6:117727278-117727300 GTGGCGTGGGTGGAGGGGGAAGG + Intergenic
1014214168 6:118736876-118736898 GGAAGGTGGGAAGAGGGGGAAGG - Intergenic
1014390089 6:120851072-120851094 GGGGTGGGGGAAGGTGGGGAGGG + Intergenic
1014533348 6:122587168-122587190 GTGGAGTGGGAGGACGGGGGAGG - Intronic
1014855497 6:126396259-126396281 GGGGGATGGGAAGAGTGGGAAGG - Intergenic
1015704910 6:136077101-136077123 TGGGGGTGGGAAGAGAGGGAGGG + Intronic
1016012943 6:139157768-139157790 TGGGCTTGGGAAGATGTGGAAGG + Intronic
1016949464 6:149566299-149566321 GGGGCGGGGAGAGACGGGGAGGG - Exonic
1017041826 6:150314289-150314311 GGGGAGGAGGAAGACGAGGAGGG + Intergenic
1017178552 6:151527663-151527685 GGGGCGTGGGGAGAAAGAGAGGG + Intronic
1017233998 6:152100400-152100422 GGGGCGGGGGAGGAAGGGGGAGG - Exonic
1017488217 6:154922003-154922025 GTGGGGTGGGAAGAGGGGGCAGG + Intronic
1017637376 6:156456223-156456245 GGGACGAGGGGAGAGGGGGATGG - Intergenic
1017954797 6:159169238-159169260 GGGGCGCGGGACGAAGGGGCCGG - Intergenic
1018453987 6:163935810-163935832 GTGGGGTGGGGGGACGGGGAAGG + Intergenic
1018486305 6:164244205-164244227 GCGGCGTGGGAAGAAGAGCATGG + Intergenic
1018757433 6:166862463-166862485 GGGGCGAGGAAAGGAGGGGACGG + Exonic
1018909031 6:168091396-168091418 GGGGCCTGGGGAGACAGAGATGG - Intergenic
1018990368 6:168669223-168669245 GGGGCGTGGGGTGTGGGGGAGGG - Intronic
1019154187 6:170027902-170027924 GGGAGGTGGGGAGACGGAGATGG + Intergenic
1019517558 7:1446548-1446570 GGGAGGAGGGGAGACGGGGAGGG + Intronic
1019531717 7:1506625-1506647 GGGGAGGGGGAGGAGGGGGAGGG - Intergenic
1019774383 7:2903858-2903880 GGGGTCTGGGAGGCCGGGGAGGG - Intergenic
1020080184 7:5282690-5282712 GGGGAGGAGGAAGAAGGGGAGGG + Intronic
1020133828 7:5574899-5574921 GGGGAGGGGGAAGACGGGTGGGG + Intergenic
1020633261 7:10666620-10666642 GGGGGGTGGGGATAAGGGGAGGG - Intergenic
1021382450 7:19984190-19984212 GAGGAGAGGGAAGAGGGGGAAGG - Intergenic
1021936790 7:25639073-25639095 AGGGCGTGGGCAGCTGGGGAGGG + Intergenic
1022047393 7:26632981-26633003 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
1022885034 7:34634176-34634198 GGGGTGTGGGGAGGTGGGGAGGG + Intergenic
1023611780 7:41978959-41978981 TGGGAGTGGCAAGACCGGGATGG + Intronic
1023837830 7:44078846-44078868 AGGGCGTGGGAAGAAAGAGAAGG + Intronic
1024005203 7:45220125-45220147 GGGGCTGGGGAAGAGGGGGCTGG - Intergenic
1024216638 7:47254338-47254360 GGGGCTCAGGGAGACGGGGAGGG - Intergenic
1025029151 7:55542401-55542423 GGGTAGTGGGGAGACGGGGATGG - Intronic
1025108982 7:56196881-56196903 GGGGAGGGGGAAGAGGGAGAGGG - Intergenic
1026125276 7:67573995-67574017 GGGGGGTGGGAGCAAGGGGAGGG + Intergenic
1026308785 7:69166175-69166197 GGGGAGGGGGAGGAGGGGGAGGG + Intergenic
1026364335 7:69632560-69632582 GGGGAGAGGGGAGAGGGGGAGGG - Intronic
1026414436 7:70163349-70163371 GGGGGGGGGGCAGAGGGGGAGGG + Intronic
1026638669 7:72105846-72105868 AGGGAGGGGGAAGAGGGGGATGG + Intronic
1026786300 7:73303786-73303808 GGGTCGTGGGGAGTGGGGGACGG - Intronic
1026872760 7:73863193-73863215 GGGGCCTGTGGACACGGGGATGG + Intronic
1027753841 7:82185542-82185564 GGGGAGGGGGAGGAGGGGGAGGG + Intronic
1029420867 7:100471213-100471235 GGGGCTGGGGAGGTCGGGGAGGG + Intronic
1029452007 7:100646687-100646709 GGGAAGTGGGGAGACGGGGTTGG - Intronic
1029516139 7:101024513-101024535 GGGAGGTGGGAGGATGGGGATGG - Intronic
1030267971 7:107640162-107640184 CAGGAGTGGGAAGAAGGGGAAGG - Intergenic
1030288109 7:107847497-107847519 GGGGAGAGGGGAGAGGGGGAGGG - Intergenic
1030606780 7:111646165-111646187 GAGGAGTGGAAAGATGGGGAAGG + Intergenic
1030775063 7:113524092-113524114 GGGGTGTGGGGAGGGGGGGAGGG + Intergenic
1031214822 7:118877159-118877181 GGGGAAGGGGAAGAAGGGGAAGG + Intergenic
1031260761 7:119517173-119517195 GGGGGGTGGGAGGCTGGGGAAGG - Intergenic
1031595093 7:123640693-123640715 GGGGAGGGGGAGGAGGGGGAGGG + Intergenic
1031823197 7:126530383-126530405 AGGGCGGGGGAAGATGGTGAGGG - Intronic
1032034914 7:128514614-128514636 GGGTCGTGGGAGGTCAGGGAAGG - Intergenic
1032155651 7:129465457-129465479 GGGGCGGGGAAAGATGGGCATGG + Intronic
1033243723 7:139701834-139701856 GAGGCGGGGGAAGGCAGGGAAGG + Intronic
1033363142 7:140652060-140652082 GTGGGGTGGGAAGAGGGGTAAGG + Intronic
1033969805 7:147025392-147025414 GGGGAGGGGGAAGAAGGGGGAGG + Intronic
1034011615 7:147535006-147535028 AGGGCGTGGGTAGGCGGGAAGGG - Intronic
1034155468 7:148952874-148952896 GGGTCGGGGGAAGTGGGGGATGG - Intergenic
1034254074 7:149714921-149714943 GGGGCCTGGGCCGAGGGGGAGGG - Intronic
1034401399 7:150863988-150864010 GGGGCCTGGGAGGAAGGGAAGGG - Intergenic
1034847558 7:154460975-154460997 TGGGGGTGGGCAGAGGGGGATGG - Intronic
1036419457 8:8582594-8582616 GGGGCGTGGGAGGCCTGAGATGG - Intergenic
1036638167 8:10565434-10565456 GGGGAGTGGGAAGAGTGGGGTGG - Intergenic
1037209355 8:16366896-16366918 GGAGAGTGGGAAGAGGGTGAAGG + Intronic
1037260607 8:17002725-17002747 GGAGGGAGGGAAGGCGGGGAGGG + Intergenic
1037461321 8:19112994-19113016 TGGGCGGGGGAAGGTGGGGATGG - Intergenic
1037901804 8:22693084-22693106 GGGGGGAGGGAAGAAGGGAAGGG + Exonic
1038866631 8:31445372-31445394 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
1039147256 8:34462818-34462840 GGGACGTGGGAAGATAGGAAAGG - Intergenic
1039250910 8:35663033-35663055 GGGGTGGGGGAAGTGGGGGATGG - Intronic
1039378920 8:37066813-37066835 AGGGCTTGGGAAGAAGAGGATGG + Intergenic
1039591992 8:38757211-38757233 GGGGCGAGGGAGGGCGGGGTGGG - Intronic
1039794582 8:40901868-40901890 GGGGTGTGGGTGGAGGGGGAGGG - Intergenic
1039992049 8:42496824-42496846 GGGCTGTGTGAAGACAGGGACGG + Intronic
1040883928 8:52238860-52238882 GGGGGGTGGGAGGAGGGTGAGGG + Intronic
1041281087 8:56211555-56211577 GGGGCGGGGGAAGAGGGGGCGGG + Intergenic
1041986964 8:63933365-63933387 GGGGAAGGGGAAGAAGGGGAAGG - Intergenic
1042179111 8:66067183-66067205 GGGCGGTGGGAAGTGGGGGAGGG - Intronic
1042246439 8:66712888-66712910 GGGGCGGGAGGAGACGGGGCGGG + Intronic
1043028914 8:75106623-75106645 GGTGCCTGGGAAGAAGGGCAAGG - Intergenic
1043111100 8:76183757-76183779 GGGGGGTGGGGGGAGGGGGAGGG - Intergenic
1043586361 8:81774079-81774101 GTGGGGTGGGGGGACGGGGAGGG + Intergenic
1044185498 8:89245941-89245963 GGGGAAGGGGAAGGCGGGGAAGG - Intergenic
1044873908 8:96645501-96645523 GGGGCGGGGGCAGAGGGGGACGG + Intronic
1045015053 8:97994193-97994215 GGGAAGAGGGAAGAGGGGGAAGG + Intronic
1045326718 8:101122756-101122778 GGGGAGGGGAAAGAAGGGGAGGG + Intergenic
1045489159 8:102656005-102656027 GGGGCGGGGGACGAGGGGCAAGG - Intergenic
1045587367 8:103553447-103553469 GGGGTGGGGGAAGGAGGGGAGGG + Intronic
1047161850 8:122389294-122389316 GGGGAGGGGGAAGAGGGGCATGG + Intergenic
1047203106 8:122782507-122782529 GGAGCGAGGGGAGAGGGGGAGGG - Intronic
1047701380 8:127452652-127452674 GGGGCGGGGGAAGAAAGGGGAGG + Intergenic
1048007616 8:130431959-130431981 GAGGAGGGGGAAGAAGGGGAAGG + Intronic
1048279961 8:133098435-133098457 GAGGCATGGGCAGACTGGGATGG + Intronic
1048512892 8:135078530-135078552 GGAGATTGGGAAGAAGGGGAGGG - Intergenic
1049063347 8:140293714-140293736 GTGGGGTGGGGAGACGGGGGAGG + Intronic
1049139117 8:140935541-140935563 GAGACAAGGGAAGACGGGGAGGG + Intronic
1049248018 8:141572976-141572998 GTGGCGGGGGGGGACGGGGAGGG + Intergenic
1049547972 8:143243381-143243403 GGGGAGGGGGATGAGGGGGAGGG + Intergenic
1049643302 8:143725142-143725164 GGGGAGGGGGGAGACGGGGGGGG + Exonic
1049765763 8:144354546-144354568 GGGGCGGGGGAGGAGGGAGACGG - Intronic
1050041488 9:1499463-1499485 CAGGGGTGGGAAGATGGGGAAGG - Intergenic
1050328702 9:4523086-4523108 GAGCTGTGGGAAGACAGGGATGG - Intronic
1050995233 9:12209378-12209400 GTGGAGTGGGGAGAGGGGGAGGG - Intergenic
1051283148 9:15463862-15463884 GGGTCATGGGAAGAAAGGGAGGG + Exonic
1051464434 9:17361203-17361225 GTGGGGTGGGGAGACGGGGGAGG - Intronic
1051714959 9:19972965-19972987 GGGGGGTGGGAAGAGGATGATGG + Intergenic
1051783955 9:20721878-20721900 GGGGAGGGGGAGGAAGGGGAGGG - Intronic
1052049745 9:23831347-23831369 GGGAGGAAGGAAGACGGGGAGGG - Intergenic
1052153582 9:25152691-25152713 GGGGTTTGGGAGGAAGGGGAGGG - Intergenic
1052918155 9:33939836-33939858 GGGGAGGGGGAGGAGGGGGAGGG + Intronic
1053019814 9:34687058-34687080 GGGGGGTGGGAAAAAGAGGAAGG + Intergenic
1055105999 9:72513670-72513692 GGGGTGTGGGGAGGGGGGGAGGG + Intergenic
1055764640 9:79649237-79649259 TGGGTGTGCGAAGACAGGGACGG + Intronic
1056065860 9:82933896-82933918 GTGGGGTGGGAAGAGGGGGGAGG - Intergenic
1056135022 9:83623029-83623051 GGGGCGCGGGAAAACGGGGAGGG + Intronic
1056835095 9:89948282-89948304 GGGGGGAGGGAGGAGGGGGAAGG + Intergenic
1057296618 9:93848377-93848399 GGGGTGGGGGGACACGGGGAGGG + Intergenic
1057489696 9:95511283-95511305 GGGGCGAGGGAGGAAGGAGAAGG - Intronic
1058377096 9:104335473-104335495 GGGTAGTGGGGAGAAGGGGATGG - Intergenic
1058550900 9:106113795-106113817 GTGGTGTGGGAAAATGGGGAAGG - Intergenic
1059123343 9:111661757-111661779 GGGGCGTGAGAAGAGGAGGCCGG + Intronic
1059409850 9:114124957-114124979 AGGGGGTGGGGAGACGGTGATGG - Intergenic
1059423524 9:114206916-114206938 GGGTTGTGGGAAGACAGAGAGGG + Intronic
1059768268 9:117403959-117403981 AGGGAGTGGAAAGAGGGGGAGGG + Intronic
1060680329 9:125557057-125557079 TGGGAGTGGGAACACAGGGATGG + Intronic
1060732684 9:126048274-126048296 GGGGCCTGGGAGGCCGGGGAGGG + Intergenic
1060949079 9:127589347-127589369 GGGGGGAGGGGAGGCGGGGAGGG + Intergenic
1060952315 9:127612186-127612208 GGGGCGGGGCAAGCCGGGGGCGG - Intergenic
1061241773 9:129378624-129378646 GGGGCGTGGGGAGTGGTGGAGGG + Intergenic
1061306583 9:129736153-129736175 GGGGCGTGGGGGTAGGGGGAGGG - Intergenic
1061321735 9:129835307-129835329 GGGGCGGGGCCAGACGGGGCAGG - Intronic
1061423439 9:130484429-130484451 GGGGAGTGGGGAGACGGGCAAGG - Intronic
1061449043 9:130658967-130658989 GGGGCCAGGGAAGACGGACAGGG + Intergenic
1061561664 9:131408093-131408115 AGGGGGTGGGAAGAAGAGGATGG + Intronic
1061578457 9:131522445-131522467 AGTGGGTGGGGAGACGGGGAGGG + Intronic
1061660648 9:132127985-132128007 GGGGCGGGGGAAGCCGAGGCTGG + Intergenic
1062242339 9:135547255-135547277 GGGGAGTGGGGGGTCGGGGAGGG - Intronic
1062421119 9:136483222-136483244 GGGGCGGGGGCAGAGGGGGCGGG - Intronic
1062697919 9:137884870-137884892 GGGGAGGGGGAAGAAGGGGAGGG - Intronic
1203464192 Un_GL000220v1:69356-69378 AGAGCGTGGGGAGACGGAGAGGG + Intergenic
1203657549 Un_KI270753v1:12970-12992 GGGAGGTGGGAAGAGGGAGAGGG - Intergenic
1185469605 X:374518-374540 GGGGCGGTGGAAAAGGGGGACGG + Intronic
1185603861 X:1355799-1355821 GGGGCATGGGAAGTAGGGGTTGG + Intronic
1185637593 X:1564454-1564476 GGGGCGTTGGGAGAGGGGGGAGG + Intergenic
1185645263 X:1611061-1611083 GGGGTGTGGACAGAAGGGGAGGG - Intergenic
1185682931 X:1903406-1903428 ATGGCGTAGGAAGACGGGAAAGG + Intergenic
1186020631 X:5251279-5251301 GGAGGGAGGGAAGACAGGGAGGG + Intergenic
1186235880 X:7509164-7509186 GGGGTGGGGGAAGTGGGGGAGGG - Intergenic
1186396759 X:9216923-9216945 GGGGGGTGGGGGGGCGGGGAGGG + Intergenic
1186428857 X:9487303-9487325 GGGGGCTGGGGAGAAGGGGAAGG - Intronic
1186576774 X:10775123-10775145 GGGGCGAGGGAGGAGGGGGAGGG + Intronic
1186640386 X:11449257-11449279 GGGGCTTGCGAAGGTGGGGATGG - Intronic
1187464324 X:19514744-19514766 GGGGAGGGGGACGAGGGGGAGGG + Intronic
1187464335 X:19514764-19514786 GGGGAGGGGGACGAGGGGGAGGG + Intronic
1187464346 X:19514784-19514806 GGGGAGGGGGACGAGGGGGAGGG + Intronic
1187790896 X:22949019-22949041 GGGGCGTGGGGAGCTGGGGGAGG - Intergenic
1188482862 X:30652910-30652932 GGGGCGTGGGAAACGCGGGAAGG + Intergenic
1188535343 X:31190608-31190630 GGGGAGGGGGAGGGCGGGGAGGG + Intronic
1189110570 X:38286015-38286037 GGGGAGGGGGAAGAGGAGGAAGG - Exonic
1189110580 X:38286042-38286064 GGGGAGGGGGAAGAGGAGGAAGG - Exonic
1189110616 X:38286141-38286163 GGGGAGGGGGAAGAGGAGGAAGG - Exonic
1189110634 X:38286189-38286211 GGGGAGGGGGAAGAGGAGGAAGG - Exonic
1189110684 X:38286351-38286373 GGGGAGGGGGAAGAGGAGGAAGG - Exonic
1189110713 X:38286438-38286460 GGGGAGGGGGAAGAGGAGGAAGG - Exonic
1189110722 X:38286459-38286481 GGGGAGGGGGAAGAGGAGGAAGG - Exonic
1189252770 X:39613980-39614002 GGTGCTTGGGGAGACGGGGGAGG + Intergenic
1189407195 X:40735615-40735637 GGGGCGGGGGGAGGCGGGGATGG + Intronic
1189612684 X:42753971-42753993 GGGGAGTGGAGAGAAGGGGAGGG + Intergenic
1189701280 X:43717708-43717730 GGGTCGAGGGAAGACTGGTAGGG + Intronic
1189701978 X:43721177-43721199 GGGGAATGGGGAGACAGGGACGG + Intronic
1189715966 X:43866549-43866571 GGGGCTGGGGAAGAAGGGAATGG + Intronic
1190035326 X:47018210-47018232 GAGGTGTGGGAAGAAGGAGATGG - Intronic
1190054989 X:47176123-47176145 GGGGTGAGGGGAGACAGGGAGGG - Intronic
1190055803 X:47180344-47180366 GGGGAGTGGGAGGGTGGGGAGGG - Intronic
1190188947 X:48259593-48259615 GTGGGGTGGGGAGAGGGGGAAGG - Intronic
1190212946 X:48461841-48461863 GGGGGATGGGAAGAAGGGGATGG - Intronic
1190213484 X:48466140-48466162 TGGGCTGGGGAAGACGGGGTGGG - Intronic
1190251580 X:48730968-48730990 GGGGTGTGGGATTAGGGGGAAGG + Intergenic
1191025462 X:55908734-55908756 GGGGCCTGGGCCGACGGGGCGGG - Intergenic
1191808980 X:65166186-65166208 GTGGGGTGGGAAGAGGGGGAGGG - Intergenic
1191902850 X:66056667-66056689 GGGGAGTGGGGAGAAGGAGAGGG + Intergenic
1192175275 X:68881197-68881219 GGGGGGTGGGAAGCAGGAGATGG + Intergenic
1192389120 X:70706307-70706329 GTGGGGTGGGAGGAGGGGGAGGG + Intronic
1193031327 X:76901294-76901316 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
1193117011 X:77785563-77785585 GGAGGGTGAGAAGAGGGGGAGGG - Intronic
1193207082 X:78761687-78761709 GTGGGGTGGGAGGAGGGGGAAGG + Intergenic
1193723139 X:85010501-85010523 GGGACTTGGGAATACTGGGAGGG - Intronic
1194611878 X:96054885-96054907 GGGGCGGGGGGAGGGGGGGAGGG - Intergenic
1195072138 X:101291379-101291401 GAGGCGTGGCGAGGCGGGGAGGG - Intronic
1195197892 X:102516922-102516944 GGGGCCTGGGGAGGCGGGGTCGG - Intergenic
1195249251 X:103026714-103026736 GGGGGGTGGGAACTAGGGGAGGG - Intergenic
1195477269 X:105301495-105301517 GGGCGGGGGGAAGATGGGGATGG - Intronic
1195504789 X:105644749-105644771 GGGGCATGGGAGGCTGGGGAAGG - Intronic
1195886479 X:109644249-109644271 GGGACGGGGAAAGAAGGGGAAGG + Intronic
1196508011 X:116472140-116472162 GGGGTGGGGGGAGGCGGGGAGGG - Intergenic
1196635660 X:117999542-117999564 GGGGGGTGGGGAGATGGGGGAGG + Intronic
1196636048 X:118003901-118003923 GGGGCTTGAGAAGATGAGGAAGG + Intronic
1197087526 X:122496827-122496849 GTGGGGTGGGGAGAGGGGGAGGG - Intergenic
1197722089 X:129752123-129752145 GTGGGGTGGGAAGACAAGGAGGG - Intronic
1197873396 X:131081576-131081598 GGGGTGGGGGTAGAGGGGGAGGG - Exonic
1198653914 X:138892959-138892981 GGGGGGTGGGCAGAAAGGGAGGG + Intronic
1198791894 X:140355117-140355139 GGTGTGTGGGGAGACGGGGGAGG - Intergenic
1198903623 X:141537306-141537328 AGGGGGTGGGGAGAGGGGGAAGG - Intergenic
1200031817 X:153303195-153303217 GGGGCTGGGGAACATGGGGAGGG - Intergenic
1200086872 X:153611400-153611422 GGGGGGTGGGAAGGGAGGGAAGG - Intergenic
1200117776 X:153776725-153776747 GGGGCGAGGCAAGGCAGGGAAGG + Intronic
1200128459 X:153829191-153829213 GGGGCGGGGGAAGGAGGGGCTGG - Intronic
1200137811 X:153883441-153883463 GGGGCGGGGGAAGCAGGAGAAGG + Intronic
1200244698 X:154516577-154516599 GAGTCGTGGGAAGACGCAGATGG + Intergenic
1200254189 X:154570684-154570706 GGGGCGTGGGATGACGGTTCGGG + Intergenic
1200256248 X:154584806-154584828 CGGGCCTGGGAACACGGGGCCGG - Intergenic
1200261521 X:154619597-154619619 CGGGCCTGGGAACACGGGGCCGG + Intergenic
1200263580 X:154633724-154633746 GGGGCGTGGGATGACGGTTCGGG - Intergenic
1200267504 X:154653894-154653916 CGGGCCTGGGAACACGGGGCCGG + Intergenic
1202013970 Y:20380565-20380587 GTGGGGTGGGAAGAGGGGGGAGG - Intergenic
1202035463 Y:20629144-20629166 GTGGGGTGGGAAGAGGGGGGAGG + Intergenic
1202052185 Y:20792711-20792733 GTGGCGTGGGAGGAGGGGGGAGG - Intergenic