ID: 940831016

View in Genome Browser
Species Human (GRCh38)
Location 2:158466044-158466066
Sequence CTATAGTTACACTACAGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940831016_940831023 28 Left 940831016 2:158466044-158466066 CCCGTCCTGTAGTGTAACTATAG No data
Right 940831023 2:158466095-158466117 GCTCTAAGCTACTCAACAGCAGG No data
940831016_940831019 -7 Left 940831016 2:158466044-158466066 CCCGTCCTGTAGTGTAACTATAG No data
Right 940831019 2:158466060-158466082 ACTATAGTATATCAGTTCCATGG No data
940831016_940831024 29 Left 940831016 2:158466044-158466066 CCCGTCCTGTAGTGTAACTATAG No data
Right 940831024 2:158466096-158466118 CTCTAAGCTACTCAACAGCAGGG No data
940831016_940831020 -6 Left 940831016 2:158466044-158466066 CCCGTCCTGTAGTGTAACTATAG No data
Right 940831020 2:158466061-158466083 CTATAGTATATCAGTTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940831016 Original CRISPR CTATAGTTACACTACAGGAC GGG (reversed) Intronic
No off target data available for this crispr