ID: 940831017

View in Genome Browser
Species Human (GRCh38)
Location 2:158466045-158466067
Sequence ACTATAGTTACACTACAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940831017_940831020 -7 Left 940831017 2:158466045-158466067 CCGTCCTGTAGTGTAACTATAGT No data
Right 940831020 2:158466061-158466083 CTATAGTATATCAGTTCCATGGG No data
940831017_940831023 27 Left 940831017 2:158466045-158466067 CCGTCCTGTAGTGTAACTATAGT No data
Right 940831023 2:158466095-158466117 GCTCTAAGCTACTCAACAGCAGG No data
940831017_940831024 28 Left 940831017 2:158466045-158466067 CCGTCCTGTAGTGTAACTATAGT No data
Right 940831024 2:158466096-158466118 CTCTAAGCTACTCAACAGCAGGG No data
940831017_940831019 -8 Left 940831017 2:158466045-158466067 CCGTCCTGTAGTGTAACTATAGT No data
Right 940831019 2:158466060-158466082 ACTATAGTATATCAGTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940831017 Original CRISPR ACTATAGTTACACTACAGGA CGG (reversed) Intronic
No off target data available for this crispr