ID: 940831018

View in Genome Browser
Species Human (GRCh38)
Location 2:158466049-158466071
Sequence ATATACTATAGTTACACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940831018_940831023 23 Left 940831018 2:158466049-158466071 CCTGTAGTGTAACTATAGTATAT No data
Right 940831023 2:158466095-158466117 GCTCTAAGCTACTCAACAGCAGG No data
940831018_940831024 24 Left 940831018 2:158466049-158466071 CCTGTAGTGTAACTATAGTATAT No data
Right 940831024 2:158466096-158466118 CTCTAAGCTACTCAACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940831018 Original CRISPR ATATACTATAGTTACACTAC AGG (reversed) Intronic
No off target data available for this crispr