ID: 940831023

View in Genome Browser
Species Human (GRCh38)
Location 2:158466095-158466117
Sequence GCTCTAAGCTACTCAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940831018_940831023 23 Left 940831018 2:158466049-158466071 CCTGTAGTGTAACTATAGTATAT No data
Right 940831023 2:158466095-158466117 GCTCTAAGCTACTCAACAGCAGG No data
940831017_940831023 27 Left 940831017 2:158466045-158466067 CCGTCCTGTAGTGTAACTATAGT No data
Right 940831023 2:158466095-158466117 GCTCTAAGCTACTCAACAGCAGG No data
940831016_940831023 28 Left 940831016 2:158466044-158466066 CCCGTCCTGTAGTGTAACTATAG No data
Right 940831023 2:158466095-158466117 GCTCTAAGCTACTCAACAGCAGG No data
940831021_940831023 -5 Left 940831021 2:158466077-158466099 CCATGGGAAAATAGTCCTGCTCT No data
Right 940831023 2:158466095-158466117 GCTCTAAGCTACTCAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940831023 Original CRISPR GCTCTAAGCTACTCAACAGC AGG Intronic
No off target data available for this crispr