ID: 940836775

View in Genome Browser
Species Human (GRCh38)
Location 2:158530683-158530705
Sequence TGCCACAACCAACATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940836775_940836783 9 Left 940836775 2:158530683-158530705 CCTGCCCCATGTTGGTTGTGGCA No data
Right 940836783 2:158530715-158530737 TGCTTCAGAGATAAGGGGTAGGG No data
940836775_940836782 8 Left 940836775 2:158530683-158530705 CCTGCCCCATGTTGGTTGTGGCA No data
Right 940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG No data
940836775_940836781 4 Left 940836775 2:158530683-158530705 CCTGCCCCATGTTGGTTGTGGCA No data
Right 940836781 2:158530710-158530732 GAGACTGCTTCAGAGATAAGGGG No data
940836775_940836780 3 Left 940836775 2:158530683-158530705 CCTGCCCCATGTTGGTTGTGGCA No data
Right 940836780 2:158530709-158530731 TGAGACTGCTTCAGAGATAAGGG No data
940836775_940836779 2 Left 940836775 2:158530683-158530705 CCTGCCCCATGTTGGTTGTGGCA No data
Right 940836779 2:158530708-158530730 TTGAGACTGCTTCAGAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940836775 Original CRISPR TGCCACAACCAACATGGGGC AGG (reversed) Intronic
No off target data available for this crispr