ID: 940836782

View in Genome Browser
Species Human (GRCh38)
Location 2:158530714-158530736
Sequence CTGCTTCAGAGATAAGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940836777_940836782 3 Left 940836777 2:158530688-158530710 CCCATGTTGGTTGTGGCATATTG No data
Right 940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG No data
940836778_940836782 2 Left 940836778 2:158530689-158530711 CCATGTTGGTTGTGGCATATTGA No data
Right 940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG No data
940836772_940836782 10 Left 940836772 2:158530681-158530703 CCCCTGCCCCATGTTGGTTGTGG No data
Right 940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG No data
940836776_940836782 4 Left 940836776 2:158530687-158530709 CCCCATGTTGGTTGTGGCATATT No data
Right 940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG No data
940836771_940836782 13 Left 940836771 2:158530678-158530700 CCTCCCCTGCCCCATGTTGGTTG No data
Right 940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG No data
940836774_940836782 9 Left 940836774 2:158530682-158530704 CCCTGCCCCATGTTGGTTGTGGC No data
Right 940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG No data
940836770_940836782 14 Left 940836770 2:158530677-158530699 CCCTCCCCTGCCCCATGTTGGTT No data
Right 940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG No data
940836775_940836782 8 Left 940836775 2:158530683-158530705 CCTGCCCCATGTTGGTTGTGGCA No data
Right 940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940836782 Original CRISPR CTGCTTCAGAGATAAGGGGT AGG Intronic
No off target data available for this crispr