ID: 940836784

View in Genome Browser
Species Human (GRCh38)
Location 2:158530742-158530764
Sequence GTCTCACCCTTAGTAACGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940836778_940836784 30 Left 940836778 2:158530689-158530711 CCATGTTGGTTGTGGCATATTGA No data
Right 940836784 2:158530742-158530764 GTCTCACCCTTAGTAACGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940836784 Original CRISPR GTCTCACCCTTAGTAACGAC AGG Intronic
No off target data available for this crispr