ID: 940841969

View in Genome Browser
Species Human (GRCh38)
Location 2:158594211-158594233
Sequence CCTCATGTCCTGTTGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940841966_940841969 2 Left 940841966 2:158594186-158594208 CCTCACTGGTGGAAGGCAACTCA No data
Right 940841969 2:158594211-158594233 CCTCATGTCCTGTTGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940841969 Original CRISPR CCTCATGTCCTGTTGCTGAT GGG Intronic
No off target data available for this crispr