ID: 940841969 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:158594211-158594233 |
| Sequence | CCTCATGTCCTGTTGCTGAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940841966_940841969 | 2 | Left | 940841966 | 2:158594186-158594208 | CCTCACTGGTGGAAGGCAACTCA | No data | ||
| Right | 940841969 | 2:158594211-158594233 | CCTCATGTCCTGTTGCTGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940841969 | Original CRISPR | CCTCATGTCCTGTTGCTGAT GGG | Intronic | ||
| No off target data available for this crispr | |||||