ID: 940844903

View in Genome Browser
Species Human (GRCh38)
Location 2:158629854-158629876
Sequence CTGTAATCCCAGCTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940844903_940844914 26 Left 940844903 2:158629854-158629876 CCCAGCCTCAGCTGGGATTACAG No data
Right 940844914 2:158629903-158629925 TTTGGATTTTTAGTAGAGTCGGG 0: 9
1: 2057
2: 177375
3: 214821
4: 129361
940844903_940844915 27 Left 940844903 2:158629854-158629876 CCCAGCCTCAGCTGGGATTACAG No data
Right 940844915 2:158629904-158629926 TTGGATTTTTAGTAGAGTCGGGG 0: 7
1: 1166
2: 106783
3: 226819
4: 153925
940844903_940844913 25 Left 940844903 2:158629854-158629876 CCCAGCCTCAGCTGGGATTACAG No data
Right 940844913 2:158629902-158629924 TTTTGGATTTTTAGTAGAGTCGG 0: 11
1: 2640
2: 209330
3: 140543
4: 70693
940844903_940844909 8 Left 940844903 2:158629854-158629876 CCCAGCCTCAGCTGGGATTACAG No data
Right 940844909 2:158629885-158629907 CACCATGCCCAGCTAATTTTTGG 0: 195
1: 480
2: 982
3: 1326
4: 1529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940844903 Original CRISPR CTGTAATCCCAGCTGAGGCT GGG (reversed) Intronic
No off target data available for this crispr