ID: 940844909

View in Genome Browser
Species Human (GRCh38)
Location 2:158629885-158629907
Sequence CACCATGCCCAGCTAATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4512
Summary {0: 195, 1: 480, 2: 982, 3: 1326, 4: 1529}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940844903_940844909 8 Left 940844903 2:158629854-158629876 CCCAGCCTCAGCTGGGATTACAG No data
Right 940844909 2:158629885-158629907 CACCATGCCCAGCTAATTTTTGG 0: 195
1: 480
2: 982
3: 1326
4: 1529
940844900_940844909 29 Left 940844900 2:158629833-158629855 CCAGGTTCAAGCAATTCTCTGCC 0: 1473
1: 1838
2: 3785
3: 43978
4: 101549
Right 940844909 2:158629885-158629907 CACCATGCCCAGCTAATTTTTGG 0: 195
1: 480
2: 982
3: 1326
4: 1529
940844906_940844909 3 Left 940844906 2:158629859-158629881 CCTCAGCTGGGATTACAGGCGCC 0: 21
1: 103
2: 284
3: 507
4: 1100
Right 940844909 2:158629885-158629907 CACCATGCCCAGCTAATTTTTGG 0: 195
1: 480
2: 982
3: 1326
4: 1529
940844904_940844909 7 Left 940844904 2:158629855-158629877 CCAGCCTCAGCTGGGATTACAGG 0: 96
1: 178
2: 248
3: 564
4: 2020
Right 940844909 2:158629885-158629907 CACCATGCCCAGCTAATTTTTGG 0: 195
1: 480
2: 982
3: 1326
4: 1529
940844899_940844909 30 Left 940844899 2:158629832-158629854 CCCAGGTTCAAGCAATTCTCTGC 0: 769
1: 2362
2: 4090
3: 31152
4: 104041
Right 940844909 2:158629885-158629907 CACCATGCCCAGCTAATTTTTGG 0: 195
1: 480
2: 982
3: 1326
4: 1529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940844909 Original CRISPR CACCATGCCCAGCTAATTTT TGG Intronic
Too many off-targets to display for this crispr