ID: 940844913

View in Genome Browser
Species Human (GRCh38)
Location 2:158629902-158629924
Sequence TTTTGGATTTTTAGTAGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423217
Summary {0: 11, 1: 2640, 2: 209330, 3: 140543, 4: 70693}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940844906_940844913 20 Left 940844906 2:158629859-158629881 CCTCAGCTGGGATTACAGGCGCC 0: 21
1: 103
2: 284
3: 507
4: 1100
Right 940844913 2:158629902-158629924 TTTTGGATTTTTAGTAGAGTCGG 0: 11
1: 2640
2: 209330
3: 140543
4: 70693
940844907_940844913 -1 Left 940844907 2:158629880-158629902 CCTGCCACCATGCCCAGCTAATT 0: 8458
1: 30905
2: 62491
3: 77788
4: 55705
Right 940844913 2:158629902-158629924 TTTTGGATTTTTAGTAGAGTCGG 0: 11
1: 2640
2: 209330
3: 140543
4: 70693
940844904_940844913 24 Left 940844904 2:158629855-158629877 CCAGCCTCAGCTGGGATTACAGG 0: 96
1: 178
2: 248
3: 564
4: 2020
Right 940844913 2:158629902-158629924 TTTTGGATTTTTAGTAGAGTCGG 0: 11
1: 2640
2: 209330
3: 140543
4: 70693
940844908_940844913 -5 Left 940844908 2:158629884-158629906 CCACCATGCCCAGCTAATTTTTG 0: 22180
1: 66270
2: 133935
3: 178969
4: 181051
Right 940844913 2:158629902-158629924 TTTTGGATTTTTAGTAGAGTCGG 0: 11
1: 2640
2: 209330
3: 140543
4: 70693
940844910_940844913 -8 Left 940844910 2:158629887-158629909 CCATGCCCAGCTAATTTTTGGAT 0: 73
1: 23204
2: 54484
3: 105848
4: 138525
Right 940844913 2:158629902-158629924 TTTTGGATTTTTAGTAGAGTCGG 0: 11
1: 2640
2: 209330
3: 140543
4: 70693
940844903_940844913 25 Left 940844903 2:158629854-158629876 CCCAGCCTCAGCTGGGATTACAG No data
Right 940844913 2:158629902-158629924 TTTTGGATTTTTAGTAGAGTCGG 0: 11
1: 2640
2: 209330
3: 140543
4: 70693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940844913 Original CRISPR TTTTGGATTTTTAGTAGAGT CGG Intronic
Too many off-targets to display for this crispr