ID: 940844915

View in Genome Browser
Species Human (GRCh38)
Location 2:158629904-158629926
Sequence TTGGATTTTTAGTAGAGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488700
Summary {0: 7, 1: 1166, 2: 106783, 3: 226819, 4: 153925}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940844906_940844915 22 Left 940844906 2:158629859-158629881 CCTCAGCTGGGATTACAGGCGCC 0: 21
1: 103
2: 284
3: 507
4: 1100
Right 940844915 2:158629904-158629926 TTGGATTTTTAGTAGAGTCGGGG 0: 7
1: 1166
2: 106783
3: 226819
4: 153925
940844903_940844915 27 Left 940844903 2:158629854-158629876 CCCAGCCTCAGCTGGGATTACAG No data
Right 940844915 2:158629904-158629926 TTGGATTTTTAGTAGAGTCGGGG 0: 7
1: 1166
2: 106783
3: 226819
4: 153925
940844910_940844915 -6 Left 940844910 2:158629887-158629909 CCATGCCCAGCTAATTTTTGGAT 0: 73
1: 23204
2: 54484
3: 105848
4: 138525
Right 940844915 2:158629904-158629926 TTGGATTTTTAGTAGAGTCGGGG 0: 7
1: 1166
2: 106783
3: 226819
4: 153925
940844907_940844915 1 Left 940844907 2:158629880-158629902 CCTGCCACCATGCCCAGCTAATT 0: 8458
1: 30905
2: 62491
3: 77788
4: 55705
Right 940844915 2:158629904-158629926 TTGGATTTTTAGTAGAGTCGGGG 0: 7
1: 1166
2: 106783
3: 226819
4: 153925
940844904_940844915 26 Left 940844904 2:158629855-158629877 CCAGCCTCAGCTGGGATTACAGG 0: 96
1: 178
2: 248
3: 564
4: 2020
Right 940844915 2:158629904-158629926 TTGGATTTTTAGTAGAGTCGGGG 0: 7
1: 1166
2: 106783
3: 226819
4: 153925
940844908_940844915 -3 Left 940844908 2:158629884-158629906 CCACCATGCCCAGCTAATTTTTG 0: 22180
1: 66270
2: 133935
3: 178969
4: 181051
Right 940844915 2:158629904-158629926 TTGGATTTTTAGTAGAGTCGGGG 0: 7
1: 1166
2: 106783
3: 226819
4: 153925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940844915 Original CRISPR TTGGATTTTTAGTAGAGTCG GGG Intronic
Too many off-targets to display for this crispr