ID: 940847914

View in Genome Browser
Species Human (GRCh38)
Location 2:158661311-158661333
Sequence CCTAAAGGGGTGGAGACAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 258}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940847914_940847923 -5 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847923 2:158661329-158661351 TTAGGAACCTCAGCTCCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
940847914_940847930 30 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847930 2:158661364-158661386 AAGCAAATGCGGTCCTGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 58
940847914_940847926 7 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847926 2:158661341-158661363 GCTCCGCGGGGGAAGAAGCTCGG 0: 1
1: 0
2: 1
3: 10
4: 84
940847914_940847929 29 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847929 2:158661363-158661385 GAAGCAAATGCGGTCCTGCGAGG 0: 1
1: 0
2: 2
3: 5
4: 72
940847914_940847928 19 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847928 2:158661353-158661375 AAGAAGCTCGGAAGCAAATGCGG 0: 2
1: 0
2: 0
3: 18
4: 165
940847914_940847924 -4 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847924 2:158661330-158661352 TAGGAACCTCAGCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 59
940847914_940847921 -7 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847921 2:158661327-158661349 CTTTAGGAACCTCAGCTCCGCGG 0: 1
1: 0
2: 0
3: 15
4: 125
940847914_940847922 -6 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847922 2:158661328-158661350 TTTAGGAACCTCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940847914 Original CRISPR CCTAAAGGGGTGGAGACAGG AGG (reversed) Exonic