ID: 940847924

View in Genome Browser
Species Human (GRCh38)
Location 2:158661330-158661352
Sequence TAGGAACCTCAGCTCCGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940847914_940847924 -4 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847924 2:158661330-158661352 TAGGAACCTCAGCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 59
940847916_940847924 -7 Left 940847916 2:158661314-158661336 CCTGTCTCCACCCCTTTAGGAAC 0: 1
1: 0
2: 1
3: 7
4: 157
Right 940847924 2:158661330-158661352 TAGGAACCTCAGCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940847924 Original CRISPR TAGGAACCTCAGCTCCGCGG GGG Exonic