ID: 940847924

View in Genome Browser
Species Human (GRCh38)
Location 2:158661330-158661352
Sequence TAGGAACCTCAGCTCCGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940847916_940847924 -7 Left 940847916 2:158661314-158661336 CCTGTCTCCACCCCTTTAGGAAC 0: 1
1: 0
2: 1
3: 7
4: 157
Right 940847924 2:158661330-158661352 TAGGAACCTCAGCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 59
940847914_940847924 -4 Left 940847914 2:158661311-158661333 CCTCCTGTCTCCACCCCTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 258
Right 940847924 2:158661330-158661352 TAGGAACCTCAGCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940847924 Original CRISPR TAGGAACCTCAGCTCCGCGG GGG Exonic
907450086 1:54540838-54540860 TTGGAGCCTCAGCTCAGCAGAGG - Intergenic
1062925708 10:1314232-1314254 GAGAAACCTCAGCTCTGCTGGGG - Intronic
1065613937 10:27500958-27500980 TCGGAACCTCAGCTCAGCCAGGG + Intergenic
1065949412 10:30638400-30638422 TTGGAACCTCAGCTCAGCCAGGG - Intergenic
1071539318 10:86466160-86466182 TAGGCACCTCACCTCCCCTGAGG - Intronic
1077171519 11:1168419-1168441 GCGGCACCTCAGCCCCGCGGAGG - Intronic
1084660862 11:70545478-70545500 GAGGACCCTCAGCTCTGCAGTGG - Intronic
1085510436 11:77085315-77085337 CAGTAACCTCAGCCCCGCTGAGG + Intronic
1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG + Intronic
1093094284 12:14954597-14954619 GAGGAAACTCAGATCCGCAGTGG - Intronic
1103972975 12:124683584-124683606 TGGGTAGCTCAGCTCTGCGGAGG - Intergenic
1104875696 12:132033068-132033090 CTGTAACCTCAGCTCCTCGGGGG - Intronic
1123068219 14:105628683-105628705 CCGGAACCTCAGCTCCTCAGTGG + Intergenic
1123092233 14:105746985-105747007 CTGGAACCTCAGCTCCTCAGTGG + Intergenic
1127123498 15:55790914-55790936 TAGGAACATAAGCTCCATGGGGG - Intergenic
1132079466 15:98852266-98852288 AAGGAGCCTCAGCCCCTCGGAGG - Intronic
1133859820 16:9584041-9584063 TAAGAACCTCAGTTCTGGGGTGG - Intergenic
1135302722 16:21344963-21344985 GAGGAACAGCAGCTCCGCGGAGG + Intergenic
1136299481 16:29324177-29324199 GAGGAAAAGCAGCTCCGCGGAGG + Intergenic
1137348584 16:47689063-47689085 TATGAACTTCAGATCCGTGGCGG + Exonic
1139485616 16:67255061-67255083 TGGGAGCCTCATCTCGGCGGTGG + Exonic
1142061226 16:88031006-88031028 GAGGAACAGCAGCTCCGCGGAGG + Intronic
1145186293 17:20797321-20797343 TAGGCCCCTCAGCTCCTAGGAGG - Intergenic
1147491366 17:40870449-40870471 GAAGAACCTCAGCTTCGGGGAGG - Intergenic
1148410821 17:47465527-47465549 TAGGCCCCTCAGCTCCTAGGAGG + Intergenic
1148497291 17:48060455-48060477 TGGGAGCCTCAGCTCAGGGGTGG - Exonic
1153878244 18:9396039-9396061 TAGGAACCAGAGCTCCTTGGAGG - Intronic
1156486016 18:37466180-37466202 CAGGGAGCTCAGCTCCGCTGGGG - Intronic
1156959596 18:43008894-43008916 TAGGAAACTGAGCTCCACAGAGG - Intronic
1158908388 18:62036095-62036117 AAGGAACATCAGCTCCACTGAGG + Intergenic
1161697420 19:5777249-5777271 TAGGAGGATCAGCTCCGGGGTGG + Intronic
1162440527 19:10689314-10689336 TAGAAATCTCCGCCCCGCGGGGG - Exonic
1164902245 19:31938189-31938211 TAGGAACCTCTACTCCCCAGTGG + Intergenic
1164922846 19:32102594-32102616 TTGGGACCTCAGCTCCCAGGTGG + Intergenic
1166137571 19:40786656-40786678 CAGGAACATCAGCTCTGCAGGGG - Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925152365 2:1624005-1624027 GAGTAACCTCAGCTCGGTGGTGG - Intergenic
937336936 2:121067980-121068002 GAGGAACCGCGGCTCTGCGGTGG + Intergenic
940847924 2:158661330-158661352 TAGGAACCTCAGCTCCGCGGGGG + Exonic
946905059 2:224407692-224407714 TAGGAATCTCAGGTCCTCGCTGG - Intergenic
949070469 2:242021331-242021353 CAGGAACATCAGCTCCCCCGAGG - Intergenic
1170545935 20:17435910-17435932 TAGGAGCACCAGCTCTGCGGGGG + Intronic
1174054761 20:47790662-47790684 TAGAAACCTCAGCCCTGGGGGGG - Intergenic
1183291432 22:37004127-37004149 TAGGAACCTCTGATCAGGGGCGG - Intronic
1184332299 22:43834474-43834496 TGGGAAGCTCAGGGCCGCGGTGG - Intronic
1184386783 22:44181311-44181333 TGGGAGCCTCAGCTCAGGGGCGG + Intronic
1184743053 22:46440173-46440195 TAAGAACCTCATCTGCTCGGAGG + Intronic
956103293 3:65790711-65790733 TAACAACCTCAGCCTCGCGGGGG + Intronic
961637711 3:128343441-128343463 TTGGACCCTTAGCTCCGGGGGGG + Intronic
980076748 4:128302054-128302076 TAGCAACCTCTGCTCCTTGGAGG - Intergenic
988790539 5:34603580-34603602 TAGGACACTCAGCTCCACTGTGG + Intergenic
993508743 5:88745230-88745252 TAGGACGCTCAGCTCTGTGGAGG - Intronic
1002284931 5:178155962-178155984 TAGGAACCTCAGCTTGGCCCAGG + Intergenic
1006309790 6:33249574-33249596 CAGCAGCCTCCGCTCCGCGGCGG + Intergenic
1007142479 6:39589659-39589681 GAGGAACATCAGATCTGCGGGGG + Intronic
1008673313 6:53794978-53795000 TAGGAAGCTCCGCGCGGCGGCGG + Exonic
1016686772 6:146890839-146890861 TAGGAACATCAGCATCGCTGGGG - Intergenic
1033033188 7:137846685-137846707 CATGAACCCCAGCTCCTCGGCGG - Exonic
1034434764 7:151058155-151058177 TGGGAACCACGGCGCCGCGGCGG - Exonic
1043296127 8:78665973-78665995 CAGGAACCTCGCCTCCGCCGCGG + Intergenic
1060515788 9:124264898-124264920 GAGGAACGTGAGCTCCGGGGAGG + Intronic
1187411183 X:19051725-19051747 TAGGAACCTCAGTTCCCATGTGG - Intronic