ID: 940849970

View in Genome Browser
Species Human (GRCh38)
Location 2:158678753-158678775
Sequence GGTCCTAGATGCTTTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940849964_940849970 0 Left 940849964 2:158678730-158678752 CCAGAGCTGGGCCAACATGGCAG 0: 1
1: 1
2: 1
3: 14
4: 199
Right 940849970 2:158678753-158678775 GGTCCTAGATGCTTTCCCTGGGG 0: 2
1: 0
2: 1
3: 14
4: 136
940849963_940849970 1 Left 940849963 2:158678729-158678751 CCCAGAGCTGGGCCAACATGGCA 0: 1
1: 1
2: 0
3: 23
4: 205
Right 940849970 2:158678753-158678775 GGTCCTAGATGCTTTCCCTGGGG 0: 2
1: 0
2: 1
3: 14
4: 136
940849959_940849970 17 Left 940849959 2:158678713-158678735 CCACGTCGATTGACTTCCCAGAG 0: 2
1: 0
2: 1
3: 3
4: 51
Right 940849970 2:158678753-158678775 GGTCCTAGATGCTTTCCCTGGGG 0: 2
1: 0
2: 1
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940849970 Original CRISPR GGTCCTAGATGCTTTCCCTG GGG Intronic