ID: 940853888

View in Genome Browser
Species Human (GRCh38)
Location 2:158714837-158714859
Sequence CTGTGCTTGTTGCTGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940853883_940853888 30 Left 940853883 2:158714784-158714806 CCTTTCCTGGTACTTTGGCTAGA No data
Right 940853888 2:158714837-158714859 CTGTGCTTGTTGCTGTTTCCAGG No data
940853884_940853888 25 Left 940853884 2:158714789-158714811 CCTGGTACTTTGGCTAGAGAGAG No data
Right 940853888 2:158714837-158714859 CTGTGCTTGTTGCTGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940853888 Original CRISPR CTGTGCTTGTTGCTGTTTCC AGG Intergenic
No off target data available for this crispr