ID: 940853905

View in Genome Browser
Species Human (GRCh38)
Location 2:158714964-158714986
Sequence TCTGAAAGGTAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940853905_940853910 27 Left 940853905 2:158714964-158714986 CCTTCTTCCCTCTACCTTTCAGA No data
Right 940853910 2:158715014-158715036 TATTAATGGCTTTAAGTTGTAGG No data
940853905_940853909 13 Left 940853905 2:158714964-158714986 CCTTCTTCCCTCTACCTTTCAGA No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940853905 Original CRISPR TCTGAAAGGTAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr