ID: 940853906

View in Genome Browser
Species Human (GRCh38)
Location 2:158714971-158714993
Sequence TAAAGACTCTGAAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940853906_940853912 30 Left 940853906 2:158714971-158714993 CCCTCTACCTTTCAGAGTCTTTA No data
Right 940853912 2:158715024-158715046 TTTAAGTTGTAGGAAGAATAGGG No data
940853906_940853910 20 Left 940853906 2:158714971-158714993 CCCTCTACCTTTCAGAGTCTTTA No data
Right 940853910 2:158715014-158715036 TATTAATGGCTTTAAGTTGTAGG No data
940853906_940853909 6 Left 940853906 2:158714971-158714993 CCCTCTACCTTTCAGAGTCTTTA No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data
940853906_940853911 29 Left 940853906 2:158714971-158714993 CCCTCTACCTTTCAGAGTCTTTA No data
Right 940853911 2:158715023-158715045 CTTTAAGTTGTAGGAAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940853906 Original CRISPR TAAAGACTCTGAAAGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr