ID: 940853908

View in Genome Browser
Species Human (GRCh38)
Location 2:158714978-158715000
Sequence AAACACATAAAGACTCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940853908_940853909 -1 Left 940853908 2:158714978-158715000 CCTTTCAGAGTCTTTATGTGTTT No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data
940853908_940853910 13 Left 940853908 2:158714978-158715000 CCTTTCAGAGTCTTTATGTGTTT No data
Right 940853910 2:158715014-158715036 TATTAATGGCTTTAAGTTGTAGG No data
940853908_940853911 22 Left 940853908 2:158714978-158715000 CCTTTCAGAGTCTTTATGTGTTT No data
Right 940853911 2:158715023-158715045 CTTTAAGTTGTAGGAAGAATAGG No data
940853908_940853912 23 Left 940853908 2:158714978-158715000 CCTTTCAGAGTCTTTATGTGTTT No data
Right 940853912 2:158715024-158715046 TTTAAGTTGTAGGAAGAATAGGG No data
940853908_940853913 24 Left 940853908 2:158714978-158715000 CCTTTCAGAGTCTTTATGTGTTT No data
Right 940853913 2:158715025-158715047 TTAAGTTGTAGGAAGAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940853908 Original CRISPR AAACACATAAAGACTCTGAA AGG (reversed) Intergenic
No off target data available for this crispr