ID: 940853909

View in Genome Browser
Species Human (GRCh38)
Location 2:158715000-158715022
Sequence TGTTTTATATATAATATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940853908_940853909 -1 Left 940853908 2:158714978-158715000 CCTTTCAGAGTCTTTATGTGTTT No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data
940853906_940853909 6 Left 940853906 2:158714971-158714993 CCCTCTACCTTTCAGAGTCTTTA No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data
940853903_940853909 20 Left 940853903 2:158714957-158714979 CCACCTGCCTTCTTCCCTCTACC No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data
940853907_940853909 5 Left 940853907 2:158714972-158714994 CCTCTACCTTTCAGAGTCTTTAT No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data
940853902_940853909 25 Left 940853902 2:158714952-158714974 CCTAACCACCTGCCTTCTTCCCT No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data
940853904_940853909 17 Left 940853904 2:158714960-158714982 CCTGCCTTCTTCCCTCTACCTTT No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data
940853905_940853909 13 Left 940853905 2:158714964-158714986 CCTTCTTCCCTCTACCTTTCAGA No data
Right 940853909 2:158715000-158715022 TGTTTTATATATAATATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940853909 Original CRISPR TGTTTTATATATAATATTAA TGG Intergenic
No off target data available for this crispr