ID: 940853910

View in Genome Browser
Species Human (GRCh38)
Location 2:158715014-158715036
Sequence TATTAATGGCTTTAAGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940853905_940853910 27 Left 940853905 2:158714964-158714986 CCTTCTTCCCTCTACCTTTCAGA No data
Right 940853910 2:158715014-158715036 TATTAATGGCTTTAAGTTGTAGG No data
940853906_940853910 20 Left 940853906 2:158714971-158714993 CCCTCTACCTTTCAGAGTCTTTA No data
Right 940853910 2:158715014-158715036 TATTAATGGCTTTAAGTTGTAGG No data
940853907_940853910 19 Left 940853907 2:158714972-158714994 CCTCTACCTTTCAGAGTCTTTAT No data
Right 940853910 2:158715014-158715036 TATTAATGGCTTTAAGTTGTAGG No data
940853908_940853910 13 Left 940853908 2:158714978-158715000 CCTTTCAGAGTCTTTATGTGTTT No data
Right 940853910 2:158715014-158715036 TATTAATGGCTTTAAGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940853910 Original CRISPR TATTAATGGCTTTAAGTTGT AGG Intergenic
No off target data available for this crispr