ID: 940855067

View in Genome Browser
Species Human (GRCh38)
Location 2:158723309-158723331
Sequence CTGTGGGGGTGGAGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940855067_940855074 -4 Left 940855067 2:158723309-158723331 CCATTTGTCCTCCACCCCCACAG No data
Right 940855074 2:158723328-158723350 ACAGCCAACTTGAGTCTCGATGG No data
940855067_940855075 -3 Left 940855067 2:158723309-158723331 CCATTTGTCCTCCACCCCCACAG No data
Right 940855075 2:158723329-158723351 CAGCCAACTTGAGTCTCGATGGG No data
940855067_940855077 5 Left 940855067 2:158723309-158723331 CCATTTGTCCTCCACCCCCACAG No data
Right 940855077 2:158723337-158723359 TTGAGTCTCGATGGGCTTCAAGG No data
940855067_940855078 27 Left 940855067 2:158723309-158723331 CCATTTGTCCTCCACCCCCACAG No data
Right 940855078 2:158723359-158723381 GACTGTGTTGTTCCGCTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940855067 Original CRISPR CTGTGGGGGTGGAGGACAAA TGG (reversed) Intergenic
No off target data available for this crispr