ID: 940856219

View in Genome Browser
Species Human (GRCh38)
Location 2:158730575-158730597
Sequence GTCAGTAGTGGGCATTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940856219_940856227 11 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856227 2:158730609-158730631 TAACCTTCAACAGGGGTTTGGGG No data
940856219_940856226 10 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856226 2:158730608-158730630 CTAACCTTCAACAGGGGTTTGGG No data
940856219_940856231 23 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856231 2:158730621-158730643 GGGGTTTGGGGTTGCCCCTGGGG No data
940856219_940856229 21 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856229 2:158730619-158730641 CAGGGGTTTGGGGTTGCCCCTGG No data
940856219_940856224 4 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856224 2:158730602-158730624 TTGCTACTAACCTTCAACAGGGG No data
940856219_940856225 9 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856225 2:158730607-158730629 ACTAACCTTCAACAGGGGTTTGG No data
940856219_940856232 24 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856232 2:158730622-158730644 GGGTTTGGGGTTGCCCCTGGGGG No data
940856219_940856223 3 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856223 2:158730601-158730623 CTTGCTACTAACCTTCAACAGGG No data
940856219_940856222 2 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856222 2:158730600-158730622 TCTTGCTACTAACCTTCAACAGG No data
940856219_940856233 25 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856233 2:158730623-158730645 GGTTTGGGGTTGCCCCTGGGGGG No data
940856219_940856230 22 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC No data
Right 940856230 2:158730620-158730642 AGGGGTTTGGGGTTGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940856219 Original CRISPR GTCAGTAGTGGGCATTCATG TGG (reversed) Intergenic