ID: 940856229

View in Genome Browser
Species Human (GRCh38)
Location 2:158730619-158730641
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940856221_940856229 9 Left 940856221 2:158730587-158730609 CCACTACTGACACTCTTGCTACT No data
Right 940856229 2:158730619-158730641 CAGGGGTTTGGGGTTGCCCCTGG No data
940856218_940856229 22 Left 940856218 2:158730574-158730596 CCCACATGAATGCCCACTACTGA No data
Right 940856229 2:158730619-158730641 CAGGGGTTTGGGGTTGCCCCTGG No data
940856219_940856229 21 Left 940856219 2:158730575-158730597 CCACATGAATGCCCACTACTGAC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 940856229 2:158730619-158730641 CAGGGGTTTGGGGTTGCCCCTGG No data
940856220_940856229 10 Left 940856220 2:158730586-158730608 CCCACTACTGACACTCTTGCTAC No data
Right 940856229 2:158730619-158730641 CAGGGGTTTGGGGTTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type