ID: 940856281 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:158730865-158730887 |
Sequence | GGTTGTCACTGGCTGGGCAG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940856281_940856299 | 29 | Left | 940856281 | 2:158730865-158730887 | CCCCTGCCCAGCCAGTGACAACC | No data | ||
Right | 940856299 | 2:158730917-158730939 | CTCCTCACCCCAGCACTGTGTGG | No data | ||||
940856281_940856291 | -1 | Left | 940856281 | 2:158730865-158730887 | CCCCTGCCCAGCCAGTGACAACC | No data | ||
Right | 940856291 | 2:158730887-158730909 | CTGGCTCCTGGGCCTCCCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940856281 | Original CRISPR | GGTTGTCACTGGCTGGGCAG GGG (reversed) | Intergenic | ||