ID: 940856288

View in Genome Browser
Species Human (GRCh38)
Location 2:158730876-158730898
Sequence CCCAGGAGCCAGGTTGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940856288_940856299 18 Left 940856288 2:158730876-158730898 CCAGTGACAACCTGGCTCCTGGG No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940856288 Original CRISPR CCCAGGAGCCAGGTTGTCAC TGG (reversed) Intergenic
No off target data available for this crispr