ID: 940856299

View in Genome Browser
Species Human (GRCh38)
Location 2:158730917-158730939
Sequence CTCCTCACCCCAGCACTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940856290_940856299 8 Left 940856290 2:158730886-158730908 CCTGGCTCCTGGGCCTCCCCCTG No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856286_940856299 22 Left 940856286 2:158730872-158730894 CCAGCCAGTGACAACCTGGCTCC No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856295_940856299 -9 Left 940856295 2:158730903-158730925 CCCCTGGCCTCTCACTCCTCACC No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856292_940856299 1 Left 940856292 2:158730893-158730915 CCTGGGCCTCCCCCTGGCCTCTC No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856288_940856299 18 Left 940856288 2:158730876-158730898 CCAGTGACAACCTGGCTCCTGGG No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856285_940856299 23 Left 940856285 2:158730871-158730893 CCCAGCCAGTGACAACCTGGCTC No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856294_940856299 -8 Left 940856294 2:158730902-158730924 CCCCCTGGCCTCTCACTCCTCAC No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856283_940856299 27 Left 940856283 2:158730867-158730889 CCTGCCCAGCCAGTGACAACCTG No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856296_940856299 -10 Left 940856296 2:158730904-158730926 CCCTGGCCTCTCACTCCTCACCC No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856282_940856299 28 Left 940856282 2:158730866-158730888 CCCTGCCCAGCCAGTGACAACCT No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856293_940856299 -5 Left 940856293 2:158730899-158730921 CCTCCCCCTGGCCTCTCACTCCT No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data
940856281_940856299 29 Left 940856281 2:158730865-158730887 CCCCTGCCCAGCCAGTGACAACC No data
Right 940856299 2:158730917-158730939 CTCCTCACCCCAGCACTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940856299 Original CRISPR CTCCTCACCCCAGCACTGTG TGG Intergenic