ID: 940856474

View in Genome Browser
Species Human (GRCh38)
Location 2:158732258-158732280
Sequence AGGGGCATTCAGAAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940856474_940856485 26 Left 940856474 2:158732258-158732280 CCATGCCCCTTCTGAATGCCCCT No data
Right 940856485 2:158732307-158732329 TCTGGAGCATAGGCTCCATGAGG No data
940856474_940856486 29 Left 940856474 2:158732258-158732280 CCATGCCCCTTCTGAATGCCCCT No data
Right 940856486 2:158732310-158732332 GGAGCATAGGCTCCATGAGGTGG No data
940856474_940856483 16 Left 940856474 2:158732258-158732280 CCATGCCCCTTCTGAATGCCCCT No data
Right 940856483 2:158732297-158732319 TGGCAACCTATCTGGAGCATAGG No data
940856474_940856482 8 Left 940856474 2:158732258-158732280 CCATGCCCCTTCTGAATGCCCCT No data
Right 940856482 2:158732289-158732311 ATTCTCTGTGGCAACCTATCTGG No data
940856474_940856480 -4 Left 940856474 2:158732258-158732280 CCATGCCCCTTCTGAATGCCCCT No data
Right 940856480 2:158732277-158732299 CCCTAGCACAGTATTCTCTGTGG No data
940856474_940856487 30 Left 940856474 2:158732258-158732280 CCATGCCCCTTCTGAATGCCCCT No data
Right 940856487 2:158732311-158732333 GAGCATAGGCTCCATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940856474 Original CRISPR AGGGGCATTCAGAAGGGGCA TGG (reversed) Intergenic
No off target data available for this crispr