ID: 940860724

View in Genome Browser
Species Human (GRCh38)
Location 2:158768098-158768120
Sequence GACTGCATAGTCACTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940860724_940860729 14 Left 940860724 2:158768098-158768120 CCCACTCTAGTGACTATGCAGTC No data
Right 940860729 2:158768135-158768157 GCCTGGGTTGCCAGTGATTGTGG No data
940860724_940860728 -2 Left 940860724 2:158768098-158768120 CCCACTCTAGTGACTATGCAGTC No data
Right 940860728 2:158768119-158768141 TCAAAAGCTGGAAGTAGCCTGGG No data
940860724_940860727 -3 Left 940860724 2:158768098-158768120 CCCACTCTAGTGACTATGCAGTC No data
Right 940860727 2:158768118-158768140 GTCAAAAGCTGGAAGTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940860724 Original CRISPR GACTGCATAGTCACTAGAGT GGG (reversed) Intergenic
No off target data available for this crispr