ID: 940864157

View in Genome Browser
Species Human (GRCh38)
Location 2:158800520-158800542
Sequence CTGTCTCCACGTCCTTCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940864157_940864161 26 Left 940864157 2:158800520-158800542 CCCATTGAAGGACGTGGAGACAG No data
Right 940864161 2:158800569-158800591 TCACAGTCACAGAGCTTAGGAGG No data
940864157_940864160 23 Left 940864157 2:158800520-158800542 CCCATTGAAGGACGTGGAGACAG No data
Right 940864160 2:158800566-158800588 TACTCACAGTCACAGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940864157 Original CRISPR CTGTCTCCACGTCCTTCAAT GGG (reversed) Intronic
No off target data available for this crispr