ID: 940871700

View in Genome Browser
Species Human (GRCh38)
Location 2:158866200-158866222
Sequence GCTCTTTTACGACCCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940871693_940871700 -6 Left 940871693 2:158866183-158866205 CCACCCCTCCCTCGGCAGCTCTT No data
Right 940871700 2:158866200-158866222 GCTCTTTTACGACCCAAAACGGG No data
940871692_940871700 -1 Left 940871692 2:158866178-158866200 CCATTCCACCCCTCCCTCGGCAG No data
Right 940871700 2:158866200-158866222 GCTCTTTTACGACCCAAAACGGG No data
940871694_940871700 -9 Left 940871694 2:158866186-158866208 CCCCTCCCTCGGCAGCTCTTTTA No data
Right 940871700 2:158866200-158866222 GCTCTTTTACGACCCAAAACGGG No data
940871695_940871700 -10 Left 940871695 2:158866187-158866209 CCCTCCCTCGGCAGCTCTTTTAC No data
Right 940871700 2:158866200-158866222 GCTCTTTTACGACCCAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940871700 Original CRISPR GCTCTTTTACGACCCAAAAC GGG Intergenic
No off target data available for this crispr