ID: 940872202

View in Genome Browser
Species Human (GRCh38)
Location 2:158869382-158869404
Sequence AAGGGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940872196_940872202 8 Left 940872196 2:158869351-158869373 CCTTCAAGTGCATGGAGCGTGAT No data
Right 940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG No data
940872195_940872202 9 Left 940872195 2:158869350-158869372 CCCTTCAAGTGCATGGAGCGTGA No data
Right 940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940872202 Original CRISPR AAGGGCCTATTGAACTCTGG GGG Intergenic