ID: 940874409

View in Genome Browser
Species Human (GRCh38)
Location 2:158885370-158885392
Sequence AAGGGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940874400_940874409 18 Left 940874400 2:158885329-158885351 CCTTTTTAACCCTTCAAGTGCAT No data
Right 940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG No data
940874402_940874409 9 Left 940874402 2:158885338-158885360 CCCTTCAAGTGCATGGAGCATGA No data
Right 940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG No data
940874403_940874409 8 Left 940874403 2:158885339-158885361 CCTTCAAGTGCATGGAGCATGAT No data
Right 940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940874409 Original CRISPR AAGGGCCTATTGAACTCTGG GGG Intergenic