ID: 940874602

View in Genome Browser
Species Human (GRCh38)
Location 2:158886686-158886708
Sequence GTGTACACACACTTCGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940874595_940874602 10 Left 940874595 2:158886653-158886675 CCCCTGGATATTAAAAACCGTAT No data
Right 940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG No data
940874601_940874602 -7 Left 940874601 2:158886670-158886692 CCGTATCACAAGGGGTGTGTACA No data
Right 940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG No data
940874592_940874602 15 Left 940874592 2:158886648-158886670 CCCGCCCCCTGGATATTAAAAAC No data
Right 940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG No data
940874591_940874602 18 Left 940874591 2:158886645-158886667 CCTCCCGCCCCCTGGATATTAAA No data
Right 940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG No data
940874596_940874602 9 Left 940874596 2:158886654-158886676 CCCTGGATATTAAAAACCGTATC No data
Right 940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG No data
940874594_940874602 11 Left 940874594 2:158886652-158886674 CCCCCTGGATATTAAAAACCGTA No data
Right 940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG No data
940874597_940874602 8 Left 940874597 2:158886655-158886677 CCTGGATATTAAAAACCGTATCA No data
Right 940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG No data
940874593_940874602 14 Left 940874593 2:158886649-158886671 CCGCCCCCTGGATATTAAAAACC No data
Right 940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940874602 Original CRISPR GTGTACACACACTTCGATAT TGG Intergenic
No off target data available for this crispr