ID: 940876963

View in Genome Browser
Species Human (GRCh38)
Location 2:158907481-158907503
Sequence TACCCCCACCACCCTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940876963_940876972 27 Left 940876963 2:158907481-158907503 CCAGTCCCAGGGTGGTGGGGGTA No data
Right 940876972 2:158907531-158907553 ACATATTTTGGACGGATAACTGG No data
940876963_940876968 15 Left 940876963 2:158907481-158907503 CCAGTCCCAGGGTGGTGGGGGTA No data
Right 940876968 2:158907519-158907541 AGGCCACCAGAAACATATTTTGG No data
940876963_940876967 -5 Left 940876963 2:158907481-158907503 CCAGTCCCAGGGTGGTGGGGGTA No data
Right 940876967 2:158907499-158907521 GGGTAAAGATGGAGAAAAGCAGG No data
940876963_940876970 19 Left 940876963 2:158907481-158907503 CCAGTCCCAGGGTGGTGGGGGTA No data
Right 940876970 2:158907523-158907545 CACCAGAAACATATTTTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940876963 Original CRISPR TACCCCCACCACCCTGGGAC TGG (reversed) Intergenic
No off target data available for this crispr