ID: 940878490

View in Genome Browser
Species Human (GRCh38)
Location 2:158922213-158922235
Sequence CATCACATGGGGCAGCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940878468_940878490 27 Left 940878468 2:158922163-158922185 CCTGCTCCGGCCCATGCCCCCTG No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878473_940878490 17 Left 940878473 2:158922173-158922195 CCCATGCCCCCTGGGCTGGCCTG No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878479_940878490 8 Left 940878479 2:158922182-158922204 CCTGGGCTGGCCTGGCCCCACCA No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878471_940878490 21 Left 940878471 2:158922169-158922191 CCGGCCCATGCCCCCTGGGCTGG No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878481_940878490 -7 Left 940878481 2:158922197-158922219 CCCCACCACTGCTTCCCATCACA No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878483_940878490 -9 Left 940878483 2:158922199-158922221 CCACCACTGCTTCCCATCACATG No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878482_940878490 -8 Left 940878482 2:158922198-158922220 CCCACCACTGCTTCCCATCACAT No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878480_940878490 -2 Left 940878480 2:158922192-158922214 CCTGGCCCCACCACTGCTTCCCA No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878476_940878490 11 Left 940878476 2:158922179-158922201 CCCCCTGGGCTGGCCTGGCCCCA No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878477_940878490 10 Left 940878477 2:158922180-158922202 CCCCTGGGCTGGCCTGGCCCCAC No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878467_940878490 28 Left 940878467 2:158922162-158922184 CCCTGCTCCGGCCCATGCCCCCT No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878474_940878490 16 Left 940878474 2:158922174-158922196 CCATGCCCCCTGGGCTGGCCTGG No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data
940878478_940878490 9 Left 940878478 2:158922181-158922203 CCCTGGGCTGGCCTGGCCCCACC No data
Right 940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940878490 Original CRISPR CATCACATGGGGCAGCCACC TGG Intergenic
No off target data available for this crispr