ID: 940879144

View in Genome Browser
Species Human (GRCh38)
Location 2:158929119-158929141
Sequence TCATGGGCCCCTGGATTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940879139_940879144 17 Left 940879139 2:158929079-158929101 CCAGGGGCTTACAGAGTGTAAAT No data
Right 940879144 2:158929119-158929141 TCATGGGCCCCTGGATTTCCAGG No data
940879138_940879144 25 Left 940879138 2:158929071-158929093 CCAAGTCTCCAGGGGCTTACAGA No data
Right 940879144 2:158929119-158929141 TCATGGGCCCCTGGATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940879144 Original CRISPR TCATGGGCCCCTGGATTTCC AGG Intergenic
No off target data available for this crispr