ID: 940881006

View in Genome Browser
Species Human (GRCh38)
Location 2:158946829-158946851
Sequence TAAAATCACCATAATGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940881006_940881013 22 Left 940881006 2:158946829-158946851 CCAGCCCCATTATGGTGATTTTA No data
Right 940881013 2:158946874-158946896 CTACTTCTCTCTCCAAAAGGTGG No data
940881006_940881015 24 Left 940881006 2:158946829-158946851 CCAGCCCCATTATGGTGATTTTA No data
Right 940881015 2:158946876-158946898 ACTTCTCTCTCCAAAAGGTGGGG No data
940881006_940881011 19 Left 940881006 2:158946829-158946851 CCAGCCCCATTATGGTGATTTTA No data
Right 940881011 2:158946871-158946893 TTCCTACTTCTCTCTCCAAAAGG No data
940881006_940881014 23 Left 940881006 2:158946829-158946851 CCAGCCCCATTATGGTGATTTTA No data
Right 940881014 2:158946875-158946897 TACTTCTCTCTCCAAAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940881006 Original CRISPR TAAAATCACCATAATGGGGC TGG (reversed) Intergenic
No off target data available for this crispr