ID: 940881286

View in Genome Browser
Species Human (GRCh38)
Location 2:158949351-158949373
Sequence CTGCTTTCCGTAGTCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940881286_940881292 14 Left 940881286 2:158949351-158949373 CCTGTTTTGACTACGGAAAGCAG No data
Right 940881292 2:158949388-158949410 GACTGTTTTACGGTCTCATTTGG No data
940881286_940881294 25 Left 940881286 2:158949351-158949373 CCTGTTTTGACTACGGAAAGCAG No data
Right 940881294 2:158949399-158949421 GGTCTCATTTGGATTATAGTGGG No data
940881286_940881293 24 Left 940881286 2:158949351-158949373 CCTGTTTTGACTACGGAAAGCAG No data
Right 940881293 2:158949398-158949420 CGGTCTCATTTGGATTATAGTGG No data
940881286_940881291 4 Left 940881286 2:158949351-158949373 CCTGTTTTGACTACGGAAAGCAG No data
Right 940881291 2:158949378-158949400 TTTGGGTACTGACTGTTTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940881286 Original CRISPR CTGCTTTCCGTAGTCAAAAC AGG (reversed) Intergenic
No off target data available for this crispr